Regulon of CadR-PbrR in Ralstonia metallidurans CH34

Properties
Regulator type:	Transcription factor
TF locus tag:	Rmet_5946, pMOL30_092, Rmet_2302, Rmet_3456
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Ralstonia
Statistics of regulated genes:
- Genes	14
- Operons	8
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 21 sites [see more]

Member of regulog collections

By taxonomy - Ralstonia
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -26 Score: 4.9 Sequence: ACTCTATATCTACTAGAGGTT Locus tag: Rmet_2303 Name: pbrA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Locus tag: Rmet_2304 Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
	Rmet_2303	pbrA	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
	Rmet_2304	lspA	Lipoprotein signal peptidase (EC 3.4.23.36)
Position: -63 Score: 6.2 Sequence: ACTCTATAGTAACTAGAGGGT Locus tag: pMOL30_091 Name: pbrA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Locus tag: pMOL30_090 Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
	pMOL30_091	pbrA	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
	pMOL30_090	lspA	Lipoprotein signal peptidase (EC 3.4.23.36)
Position: -44 Score: 6.2 Sequence: ACCCTCTAGTTACTATAGAGT Locus tag: pMOL30_092 Name: pbrR Funciton: Lead resistance transcriptional regulator, MerR family Locus tag: pMOL30_093 Name: pbrT Funciton: Pb(II) uptake protein, ILT family
	pMOL30_092	pbrR	Lead resistance transcriptional regulator, MerR family
	pMOL30_093	pbrT	Pb(II) uptake protein, ILT family
Position: -44 Score: 6.2 Sequence: ACCCTCTAGTTACTATAGAGT Locus tag: Rmet_5946 Name: pbrR Funciton: Lead resistance transcriptional regulator, MerR family Locus tag: Rmet_5945 Name: pbrT Funciton: Pb(II) uptake protein, ILT family
	Rmet_5946	pbrR	Lead resistance transcriptional regulator, MerR family
	Rmet_5945	pbrT	Pb(II) uptake protein, ILT family
Position: -63 Score: 6.2 Sequence: ACTCTATAGTAACTAGAGGGT Locus tag: Rmet_5947 Name: pbrA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) Locus tag: Rmet_5948 Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36) Locus tag: Rmet_5949 Name: pbrD Funciton: Pb(II) binding protein
	Rmet_5947	pbrA	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
	Rmet_5948	lspA	Lipoprotein signal peptidase (EC 3.4.23.36)
	Rmet_5949	pbrD	Pb(II) binding protein
Position: -30 Score: 5.9 Sequence: ACCCTGTAATTACTACAGGGA Locus tag: Rmet_3456 Name: cadR Funciton: Cadmium resistance transcriptional regulator, MerR family
	Rmet_3456	cadR	Cadmium resistance transcriptional regulator, MerR family
Position: -46 Score: 6.1 Sequence: ACCCTGTAGCGACTAAAGGGT Locus tag: Rmet_4594 Name: cadA Funciton: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
	Rmet_4594	cadA	Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3)
Position: -115 Score: 6 Sequence: ACCCTGTAGTCACTACAGACT Locus tag: Rmet_5969 Name: Rpic_1752 Funciton: hypothetical protein
	Rmet_5969	Rpic_1752	hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CadR-PbrR in Ralstonia metallidurans CH34

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --