Regulog CadR-PbrR - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator |
| Biological process: | Lead resistance; Cadmium resistance |
| Effector: | Lead ion, (Pb2+); Cadmium, ion (Cd2+) |
| Phylum: | Proteobacteria/Gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By trascription factor - CadR-PbrR
- By TF family - MerR
- By effector - Lead ion, (Pb2+)
- By effector - Cadmium, ion (Cd2+)
- By pathway - Lead resistance
- By pathway - Cadmium resistance
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | ||
| Shewanella putrefaciens CN-32 | 16 | 4 |
| Shewanella sp W3-18-1 | 11 | 4 |
| Shewanella sp ANA-3 | 1 | 1 |
| Shewanella sp MR-4 | ||
| Shewanella sp MR-7 | ||
| Shewanella baltica OS155 | ||
| Shewanella denitrificans OS217 | ||
| Shewanella frigidimarina NCIMB 400 | 2 | 1 |
| Shewanella amazonensis SB2B | ||
| Shewanella loihica PV-4 | ||
| Shewanella pealeana ATCC 700345 | ||
| Shewanella halifaxensis HAW-EB4 | ||
| Shewanella piezotolerans WP3 | ||
| Shewanella sediminis HAW-EB3 | ||
| Shewanella woodyi ATCC 51908 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| czcD2 |
|
*2
Shewanella putrefaciens CN-32 Site: position = -61 score = 5.61753 sequence = ACCTTATAGTGACTTTATAGT Gene: Sputcn32_0221: Co/Zn/Cd efflux protein Site: position = -61 score = 5.61753 sequence = ACCTTATAGTGACTTTATAGT Gene: Sputcn32_0195: Co/Zn/Cd efflux protein |
*3
Shewanella sp W3-18-1 Site: position = -61 score = 5.61753 sequence = ACCTTATAGTGACTTTATAGT Gene: Sputw3181_0520: Co/Zn/Cd efflux protein Site: position = -61 score = 5.61753 sequence = ACCTTATAGTGACTTTATAGT Gene: Sputw3181_0414: Co/Zn/Cd efflux protein Site: position = -61 score = 5.61753 sequence = ACCTTATAGTGACTTTATAGT Gene: Sputw3181_0439: Co/Zn/Cd efflux protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
Co/Zn/Cd efflux protein |
| lspA |
|
2
Shewanella putrefaciens CN-32 Gene: Sputcn32_0222: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Sputcn32_0196: Lipoprotein signal peptidase (EC 3.4.23.36) |
3
Shewanella sp W3-18-1 Gene: Sputw3181_0440: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Sputw3181_0519: Lipoprotein signal peptidase (EC 3.4.23.36) Gene: Sputw3181_0415: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
|
|
|
|
|
|
|
|
|
|
|
|
Lipoprotein signal peptidase (EC 3.4.23.36) |
| CRON 2. | |||||||||||||||||
| cadA |
|
|
|
|
|
|
|
|
*
Shewanella frigidimarina NCIMB 400 Site: position = -61 score = 5.84283 sequence = ACTCTATAGTGACTATAGAGA Gene: Sfri_3462: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
|
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
| lspA |
|
|
|
Gene: Shewana3_4320: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
|
|
|
Gene: Sfri_3463: Lipoprotein signal peptidase (EC 3.4.23.36) |
|
|
|
|
|
|
|
Lipoprotein signal peptidase (EC 3.4.23.36) |
| CRON 3. | |||||||||||||||||
| czcD |
|
*2
Shewanella putrefaciens CN-32 Site: position = -59 score = 6.35953 sequence = ACTCTATAGTAACTACAGAGT Gene: Sputcn32_0229: Co/Zn/Cd efflux protein Site: position = -59 score = 6.35953 sequence = ACTCTATAGTAACTACAGAGT Gene: Sputcn32_1972: Co/Zn/Cd efflux protein |
*
Shewanella sp W3-18-1 Site: position = -59 score = 6.35953 sequence = ACTCTATAGTAACTACAGAGT Gene: Sputw3181_1169: Co/Zn/Cd efflux protein |
*
Shewanella sp ANA-3 Site: position = -57 score = 6.29717 sequence = ACTCTATAGTAACTATAGAGT Gene: Shewana3_4157: Co/Zn/Cd efflux protein |
|
|
|
|
|
|
|
|
|
|
|
|
Co/Zn/Cd efflux protein |
| Sputcn32_0228 |
|
2
Shewanella putrefaciens CN-32 Gene: Sputcn32_0228: hypothetical protein Gene: Sputcn32_1971: hypothetical protein |
Gene: Sputw3181_1168: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| czcC |
|
2
Shewanella putrefaciens CN-32 Gene: Sputcn32_0227: Heavy metal RND efflux outer membrane protein Gene: Sputcn32_1970: Heavy metal RND efflux outer membrane protein |
Gene: Sputw3181_1167: Heavy metal RND efflux outer membrane protein |
Gene: Shewana3_4156: Heavy metal RND efflux outer membrane protein |
|
|
|
|
Gene: Sfri_3455: Heavy metal RND efflux outer membrane protein |
|
|
Gene: Spea_0385: Heavy metal RND efflux outer membrane protein |
Gene: Shal_3906: Heavy metal RND efflux outer membrane protein |
|
|
|
Heavy metal RND efflux outer membrane protein |
| czcB |
|
2
Shewanella putrefaciens CN-32 Gene: Sputcn32_0226: Heavy metal efflux RND transporter, membrane fusion protein Gene: Sputcn32_1969: Heavy metal efflux RND transporter, membrane fusion protein |
Gene: Sputw3181_1166: Heavy metal efflux RND transporter, membrane fusion protein |
Gene: Shewana3_4155: Heavy metal efflux RND transporter, membrane fusion protein |
|
|
|
|
Gene: Sfri_3456: Heavy metal efflux RND transporter, membrane fusion protein |
|
|
Gene: Spea_0386: Heavy metal efflux RND transporter, membrane fusion protein |
Gene: Shal_3905: Heavy metal efflux RND transporter, membrane fusion protein |
|
|
|
Heavy metal efflux RND transporter, membrane fusion protein |
| czcA |
|
2
Shewanella putrefaciens CN-32 Gene: Sputcn32_0225: Heavy metal efflux RND transmembrane protein Gene: Sputcn32_1968: Heavy metal efflux RND transmembrane protein |
Gene: Sputw3181_1165: Heavy metal efflux RND transmembrane protein |
Gene: Shewana3_4154: Heavy metal efflux RND transmembrane protein |
|
|
|
|
Gene: Sfri_3457: Heavy metal efflux RND transmembrane protein |
|
|
Gene: Spea_0387: Heavy metal efflux RND transmembrane protein |
Gene: Shal_3904: Heavy metal efflux RND transmembrane protein |
|
|
|
Heavy metal efflux RND transmembrane protein |
| Sputcn32_1967 |
|
Gene: Sputcn32_1967: hypothetical protein |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
hypothetical protein |
| cadA |
|
Gene: Sputcn32_1966: Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Lead, cadmium, zinc and mercury transporting ATPase (EC 3.6.3.3) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |