Regulon of CadR-PbrR in Shewanella sp W3-18-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Sputw3181_0521, Sputw3181_0438, Sputw3181_0413, Sputw3181_1170
Regulator family:	MerR
Regulation mode:	activator
Biological process:	Lead resistance; Cadmium resistance
Effector:	Lead ion, (Pb2+); Cadmium, ion (Cd2+)
Regulog:	CadR-PbrR - Shewanellaceae
Statistics of regulated genes:
- Genes	11
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By trascription factor - CadR-PbrR
By TF family - MerR
By effector - Lead ion, (Pb2+)
By effector - Cadmium, ion (Cd2+)
By pathway - Lead resistance
By pathway - Cadmium resistance

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 5.6 Sequence: ACCTTATAGTGACTTTATAGT Locus tag: Sputw3181_0414 Name: czcD2 Funciton: Co/Zn/Cd efflux protein Locus tag: Sputw3181_0415 Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
	Sputw3181_0414	czcD2	Co/Zn/Cd efflux protein
	Sputw3181_0415	lspA	Lipoprotein signal peptidase (EC 3.4.23.36)
Position: -61 Score: 5.6 Sequence: ACCTTATAGTGACTTTATAGT Locus tag: Sputw3181_0439 Name: czcD2 Funciton: Co/Zn/Cd efflux protein Locus tag: Sputw3181_0440 Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
	Sputw3181_0439	czcD2	Co/Zn/Cd efflux protein
	Sputw3181_0440	lspA	Lipoprotein signal peptidase (EC 3.4.23.36)
Position: -59 Score: 6.4 Sequence: ACTCTATAGTAACTACAGAGT Locus tag: Sputw3181_1169 Name: czcD Funciton: Co/Zn/Cd efflux protein Locus tag: Sputw3181_1168 Name: null Funciton: hypothetical protein Locus tag: Sputw3181_1167 Name: czcC Funciton: Heavy metal RND efflux outer membrane protein Locus tag: Sputw3181_1166 Name: czcB Funciton: Heavy metal efflux RND transporter, membrane fusion protein Locus tag: Sputw3181_1165 Name: czcA Funciton: Heavy metal efflux RND transmembrane protein
	Sputw3181_1169	czcD	Co/Zn/Cd efflux protein
	Sputw3181_1168		hypothetical protein
	Sputw3181_1167	czcC	Heavy metal RND efflux outer membrane protein
	Sputw3181_1166	czcB	Heavy metal efflux RND transporter, membrane fusion protein
	Sputw3181_1165	czcA	Heavy metal efflux RND transmembrane protein
Position: -61 Score: 5.6 Sequence: ACCTTATAGTGACTTTATAGT Locus tag: Sputw3181_0520 Name: czcD2 Funciton: Co/Zn/Cd efflux protein Locus tag: Sputw3181_0519 Name: lspA Funciton: Lipoprotein signal peptidase (EC 3.4.23.36)
	Sputw3181_0520	czcD2	Co/Zn/Cd efflux protein
	Sputw3181_0519	lspA	Lipoprotein signal peptidase (EC 3.4.23.36)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD