Regulog CueR - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | MerR |
| Regulation mode: | activator (repressor) |
| Biological process: | Copper resistance |
| Effector: | Copper ion, (Cu+) |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - CueR
- By TF family - MerR
- By effector - Copper ion, (Cu+)
- By pathway - Copper resistance
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | ||
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Marinomonas sp. MWYL1 | ||
| Saccharophagus degradans 2-40 | 3 | 3 |
| Teredinibacter turnerae T7901 | ||
| Cellvibrio japonicus Ueda107 | 6 | 4 |
| Chromohalobacter salexigens DSM 3043 | ||
| Reinekea sp. MED297 | ||
| Alcanivorax borkumensis SK2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| copZ |
|
|
|
|
|
|
*
Saccharophagus degradans 2-40 Site: position = -75 score = 4.60486 sequence = ACCTTACCACAATGGGAGACA Gene: Sde_1951: Copper chaperone |
|
*2
Cellvibrio japonicus Ueda107 Site: position = -63 score = 5.32291 sequence = ACCTTACCATGATGTCAAGGA Gene: CJA_2023: Copper chaperone Site: position = -60 score = 4.87048 sequence = ACCTTGCCACCGAGGCAAGCC Gene: CJA_1835: Copper chaperone |
|
|
|
Copper chaperone |
| CRON 2. | |||||||||||||
| copA |
|
|
|
|
|
|
*
Saccharophagus degradans 2-40 Site: position = -54 score = 5.19593 sequence = ACTTTCCCACGATGGCAAGGA Gene: Sde_1952: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
*2
Cellvibrio japonicus Ueda107 Site: position = -247 score = 5.32291 sequence = ACCTTACCATGATGTCAAGGA Gene: CJA_2024: Copper-translocating P-type ATPase (EC 3.6.3.4) Site: position = -58 score = 6.13588 sequence = ACCTTACCATGATGGGAAGGT Gene: CJA_1836: Copper-translocating P-type ATPase (EC 3.6.3.4) |
|
|
|
Copper-translocating P-type ATPase (EC 3.6.3.4) |
| cueR |
|
|
|
|
|
|
*
Saccharophagus degradans 2-40 Site: position = -59 score = 5.55434 sequence = ACCTTCCTATAATGGGAGGGT Gene: Sde_1950: Copper-responsive transcriptional regulator, MerR family |
|
2
Cellvibrio japonicus Ueda107 Gene: CJA_2025: Copper-responsive transcriptional regulator, MerR family Gene: CJA_1837: Copper-responsive transcriptional regulator, MerR family |
|
|
|
Copper-responsive transcriptional regulator, MerR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |