Regulon of CueR in Cellvibrio japonicus Ueda107

Properties
Regulator type:	Transcription factor
TF locus tag:	CJA_1837, CJA_2025
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	6
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -58 Score: 6.1 Sequence: ACCTTACCATGATGGGAAGGT Locus tag: CJA_1836 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: CJA_1837 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	CJA_1836	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	CJA_1837	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -60 Score: 4.9 Sequence: ACCTTGCCACCGAGGCAAGCC Locus tag: CJA_1835 Name: copZ Funciton: Copper chaperone
	CJA_1835	copZ	Copper chaperone
Position: -247 Score: 5.3 Sequence: ACCTTACCATGATGTCAAGGA Locus tag: CJA_2024 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: CJA_2025 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	CJA_2024	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
	CJA_2025	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -63 Score: 5.3 Sequence: ACCTTACCATGATGTCAAGGA Locus tag: CJA_2023 Name: copZ Funciton: Copper chaperone
	CJA_2023	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD