Regulon of CueR in Saccharophagus degradans 2-40

Properties
Regulator type:	Transcription factor
TF locus tag:	Sde_1950
Regulator family:	MerR
Regulation mode:	activator (repressor)
Biological process:	Copper resistance
Effector:	Copper ion, (Cu+)
Regulog:	CueR - Oceanospirillales/Alteromonadales
Statistics of regulated genes:
- Genes	3
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Oceanospirillales/Alteromonadales
By trascription factor - CueR
By TF family - MerR
By effector - Copper ion, (Cu+)
By pathway - Copper resistance

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 5.2 Sequence: ACTTTCCCACGATGGCAAGGA Locus tag: Sde_1952 Name: copA Funciton: Copper-translocating P-type ATPase (EC 3.6.3.4)
	Sde_1952	copA	Copper-translocating P-type ATPase (EC 3.6.3.4)
Position: -59 Score: 5.6 Sequence: ACCTTCCTATAATGGGAGGGT Locus tag: Sde_1950 Name: cueR Funciton: Copper-responsive transcriptional regulator, MerR family
	Sde_1950	cueR	Copper-responsive transcriptional regulator, MerR family
Position: -75 Score: 4.6 Sequence: ACCTTACCACAATGGGAGACA Locus tag: Sde_1951 Name: copZ Funciton: Copper chaperone
	Sde_1951	copZ	Copper chaperone

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD