Regulog SMb20537 - Rhizobiales

Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By pathway - Sugar utilization
Genome | Genes | Operons |
---|---|---|
Agrobacterium tumefaciens str. C58 (Cereon) | 5 | 2 |
Azorhizobium caulinodans ORS 571 | ||
Bartonella quintana str. Toulouse | ||
Bradyrhizobium japonicum USDA 110 | ||
Bradyrhizobium sp. BTAi1 | ||
Brucella melitensis 16M | ||
Mesorhizobium loti MAFF303099 | ||
Mesorhizobium sp. BNC1 | ||
Nitrobacter winogradskyi Nb-255 | ||
Rhizobium etli CFN 42 | 4 | 2 |
Rhizobium leguminosarum bv. viciae 3841 | 4 | 2 |
Rhizobium sp. NGR234 | 5 | 2 |
Rhodopseudomonas palustris CGA009 | ||
Sinorhizobium meliloti 1021 | 5 | 2 |
Xanthobacter autotrophicus Py2 |
Genes | Function | |||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | ||||||||||||||||
SMb20537 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -69 score = 5.47958 sequence = TTCTTGCAAATTTTCTTAGT Gene: Atu3107: Transcriptional regulator, LacI family |
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -37 score = 5.43477 sequence = GTATTGCAAATTTGCGCTAT Gene: RHE_CH00074: Transcriptional regulator, LacI family |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -38 score = 6.2044 sequence = TTCTTGCAAATTTGCATTAT Gene: RL0083: Transcriptional regulator, LacI family |
*
Rhizobium sp. NGR234 Site: position = -38 score = 5.71711 sequence = CACTTGCAAATTTGCATTGT Gene: NGR_c15120: Transcriptional regulator, LacI family |
|
*
Sinorhizobium meliloti 1021 Site: position = -38 score = 5.97256 sequence = CTCTTGCAAATTTGCATTGA Gene: SMb20537: Transcriptional regulator, LacI family |
|
Transcriptional regulator, LacI family |
COG4289 |
Gene: Atu3108: Uncharacterized protein conserved in bacteria |
|
|
|
|
|
|
|
|
Gene: RHE_CH00075: Uncharacterized protein conserved in bacteria |
Gene: RL0084: Uncharacterized protein conserved in bacteria |
Gene: NGR_c15110: Uncharacterized protein conserved in bacteria |
|
Gene: SMb20536: Uncharacterized protein conserved in bacteria |
|
Uncharacterized protein conserved in bacteria |
COG0111 |
Gene: Atu3109: Phosphoglycerate dehydrogenase and related dehydrogenases |
|
|
|
|
|
|
|
|
Gene: RHE_CH00076: Phosphoglycerate dehydrogenase and related dehydrogenases |
Gene: RL0085: Phosphoglycerate dehydrogenase and related dehydrogenases |
Gene: NGR_c15100: Phosphoglycerate dehydrogenase and related dehydrogenases |
|
Gene: SMb20535: Phosphoglycerate dehydrogenase and related dehydrogenases |
|
Phosphoglycerate dehydrogenase and related dehydrogenases |
COG1082 |
Gene: Atu3110: Sugar phosphate isomerases/epimerases |
|
|
|
|
|
|
|
|
|
|
Gene: NGR_c15090: Sugar phosphate isomerases/epimerases |
|
Gene: SMb20534: Sugar phosphate isomerases/epimerases |
|
Sugar phosphate isomerases/epimerases |
CRON 2. | ||||||||||||||||
SMb20538 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -69 score = 5.47958 sequence = ACTAAGAAAATTTGCAAGAA Gene: Atu3106: Sugar ABC transporter, substrate-binding protein |
|
|
|
|
|
|
|
|
*
Rhizobium etli CFN 42 Site: position = -129 score = 5.43477 sequence = ATAGCGCAAATTTGCAATAC Gene: RHE_CH00073: Sugar ABC transporter, substrate-binding protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -129 score = 6.2044 sequence = ATAATGCAAATTTGCAAGAA Gene: RL0082: Sugar ABC transporter, substrate-binding protein |
*
Rhizobium sp. NGR234 Site: position = -49 score = 5.71711 sequence = ACAATGCAAATTTGCAAGTG Gene: NGR_c15130: Sugar ABC transporter, substrate-binding protein |
|
*
Sinorhizobium meliloti 1021 Site: position = -129 score = 5.97256 sequence = TCAATGCAAATTTGCAAGAG Gene: SMb20538: Sugar ABC transporter, substrate-binding protein |
|
Sugar ABC transporter, substrate-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |