Regulon of SMb20537 in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_c15120
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Regulog:	SMb20537 - Rhizobiales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 10 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By pathway - Sugar utilization

Regulated operons
	Locus Tag	Name	Function
Position: -49 Score: 5.7 Sequence: ACAATGCAAATTTGCAAGTG Locus tag: NGR_c15130 Name: SMb20538 Funciton: Sugar ABC transporter, substrate-binding protein
	NGR_c15130	SMb20538	Sugar ABC transporter, substrate-binding protein
Position: -38 Score: 5.7 Sequence: CACTTGCAAATTTGCATTGT Locus tag: NGR_c15120 Name: SMb20537 Funciton: Transcriptional regulator, LacI family Locus tag: NGR_c15110 Name: COG4289 Funciton: Uncharacterized protein conserved in bacteria Locus tag: NGR_c15100 Name: COG0111 Funciton: Phosphoglycerate dehydrogenase and related dehydrogenases Locus tag: NGR_c15090 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
	NGR_c15120	SMb20537	Transcriptional regulator, LacI family
	NGR_c15110	COG4289	Uncharacterized protein conserved in bacteria
	NGR_c15100	COG0111	Phosphoglycerate dehydrogenase and related dehydrogenases
	NGR_c15090	COG1082	Sugar phosphate isomerases/epimerases

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD