Orthologous regulated operons containing COG0111 gene

Properties
Regulog:	SMb20537 - Rhizobiales
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	Sugar utilization
Effector:
Phylum:	Proteobacteria/Alpha

Built upon 10 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Agrobacterium tumefaciens str. C58 (Cereon)
Position: -69 Score: 5.47958 Sequence: TTCTTGCAAATTTTCTTAGT Locus tag: Atu3107 Name: SMb20537 Funciton: Transcriptional regulator, LacI family Locus tag: Atu3108 Name: COG4289 Funciton: Uncharacterized protein conserved in bacteria Locus tag: Atu3109 Name: COG0111 Funciton: Phosphoglycerate dehydrogenase and related dehydrogenases Locus tag: Atu3110 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
SMb20537-COG4289-COG0111-COG1082	-69	5.5	TTCTTGCAAATTTTCTTAGT	Atu3107
Rhizobium etli CFN 42
Position: -37 Score: 5.43477 Sequence: GTATTGCAAATTTGCGCTAT Locus tag: RHE_CH00074 Name: SMb20537 Funciton: Transcriptional regulator, LacI family Locus tag: RHE_CH00075 Name: COG4289 Funciton: Uncharacterized protein conserved in bacteria Locus tag: RHE_CH00076 Name: COG0111 Funciton: Phosphoglycerate dehydrogenase and related dehydrogenases
SMb20537-COG4289-COG0111	-37	5.4	GTATTGCAAATTTGCGCTAT	RHE_CH00074
Rhizobium leguminosarum bv. viciae 3841
Position: -38 Score: 6.2044 Sequence: TTCTTGCAAATTTGCATTAT Locus tag: RL0083 Name: SMb20537 Funciton: Transcriptional regulator, LacI family Locus tag: RL0084 Name: COG4289 Funciton: Uncharacterized protein conserved in bacteria Locus tag: RL0085 Name: COG0111 Funciton: Phosphoglycerate dehydrogenase and related dehydrogenases
SMb20537-COG4289-COG0111	-38	6.2	TTCTTGCAAATTTGCATTAT	RL0083
Rhizobium sp. NGR234
Position: -38 Score: 5.71711 Sequence: CACTTGCAAATTTGCATTGT Locus tag: NGR_c15120 Name: SMb20537 Funciton: Transcriptional regulator, LacI family Locus tag: NGR_c15110 Name: COG4289 Funciton: Uncharacterized protein conserved in bacteria Locus tag: NGR_c15100 Name: COG0111 Funciton: Phosphoglycerate dehydrogenase and related dehydrogenases Locus tag: NGR_c15090 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
SMb20537-COG4289-COG0111-COG1082	-38	5.7	CACTTGCAAATTTGCATTGT	NGR_c15120
Sinorhizobium meliloti 1021
Position: -38 Score: 5.97256 Sequence: CTCTTGCAAATTTGCATTGA Locus tag: SMb20537 Name: SMb20537 Funciton: Transcriptional regulator, LacI family Locus tag: SMb20536 Name: COG4289 Funciton: Uncharacterized protein conserved in bacteria Locus tag: SMb20535 Name: COG0111 Funciton: Phosphoglycerate dehydrogenase and related dehydrogenases Locus tag: SMb20534 Name: COG1082 Funciton: Sugar phosphate isomerases/epimerases
SMb20537-COG4289-COG0111-COG1082	-38	6	CTCTTGCAAATTTGCATTGA	SMb20537