Regulog RbsR2 - Rhodobacterales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodobacterales
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Hyphomonas neptunium ATCC 15444 | ||
| Jannaschia sp. CCS1 | ||
| Loktanella vestfoldensis SKA53 | ||
| Oceanicaulis alexandrii HTCC2633 | ||
| Oceanicola batsensis HTCC2597 | ||
| Oceanicola granulosus HTCC2516 | ||
| Paracoccus denitrificans PD1222 | ||
| Rhodobacter sphaeroides 2.4.1 | 7 | 2 |
| Rhodobacterales bacterium HTCC2654 | ||
| Roseobacter sp. MED193 | ||
| Roseovarius nubinhibens ISM | ||
| Roseovarius sp. 217 | ||
| Silicibacter TM1040 | ||
| Silicibacter pomeroyi DSS-3 | ||
| Sulfitobacter sp. EE-36 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| COG0624 |
|
|
|
|
|
|
|
*
Rhodobacter sphaeroides 2.4.1 Site: position = -70 score = 5.97811 sequence = GTTGTAAACCGCTTTACTGA Gene: RSP_3695: Acetylornithine deacetylase (EC 3.5.1.16) |
|
|
|
|
|
|
|
Acetylornithine deacetylase-like protein |
| CRON 2. | ||||||||||||||||
| rbsR2 |
|
|
|
|
|
|
|
*
Rhodobacter sphaeroides 2.4.1 Site: position = -48 score = 5.67699 sequence = TTACTAAACCGATTTACTTC Site: position = -61 score = 5.34426 sequence = CAGATAAACCAGTTTACTAA Gene: RSP_3686: Transcriptional repressor of ribose utilization, LacI family |
|
|
|
|
|
|
|
Transcriptional repressor of ribose utilization, LacI family |
| rbsA |
|
|
|
|
|
|
|
Gene: RSP_3687: Ribose ABC transporter, periplasmic ribose-binding protein rbsA |
|
|
|
|
|
|
|
Ribose ABC transporter, periplasmic ribose-binding protein rbsA |
| rbsB |
|
|
|
|
|
|
|
Gene: RSP_3688: Ribose ABC transporter, ATP-binding protein rbsB |
|
|
|
|
|
|
|
Ribose ABC transporter, ATP-binding protein rbsB |
| rbsC |
|
|
|
|
|
|
|
Gene: RSP_3689: Ribose ABC transporter, inner membrane protein rbsC |
|
|
|
|
|
|
|
Ribose ABC transporter, inner membrane protein rbsC |
| COG1735 |
|
|
|
|
|
|
|
Gene: RSP_3690: phosphotriesterase-like protein |
|
|
|
|
|
|
|
phosphotriesterase-like protein |
| COG5426 |
|
|
|
|
|
|
|
Gene: RSP_3691: Uncharacterized membrane protein |
|
|
|
|
|
|
|
Uncharacterized membrane protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |