Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing rbsA gene

Properties
Regulog: RbsR2 - Rhodobacterales
Regulator type: Transcription factor
Regulator family: LacI
Regulation mode: repressor
Biological process: Ribose utilization
Effector: Ribose
Phylum: Proteobacteria/Alpha
Built upon 3 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Rhodobacter sphaeroides 2.4.1
Position: -61
Score: 5.34426
Sequence: CAGATAAACCAGTTTACTAA
Position: -48
Score: 5.67699
Sequence: TTACTAAACCGATTTACTTC
Locus tag: RSP_3686
Name: rbsR2
Funciton: Transcriptional repressor of ribose utilization, LacI family
Locus tag: RSP_3687
Name: rbsA
Funciton: Ribose ABC transporter, periplasmic ribose-binding protein rbsA
Locus tag: RSP_3688
Name: rbsB
Funciton: Ribose ABC transporter, ATP-binding protein rbsB
Locus tag: RSP_3689
Name: rbsC
Funciton: Ribose ABC transporter, inner membrane protein rbsC
Locus tag: RSP_3690
Name: COG1735
Funciton: phosphotriesterase-like protein
Locus tag: RSP_3691
Name: COG5426
Funciton: Uncharacterized membrane protein
rbsR2-rbsA-rbsB-rbsC-COG1735-COG5426 -61 5.3 CAGATAAACCAGTTTACTAA RSP_3686
-48 5.7 TTACTAAACCGATTTACTTC