Regulon of RbsR2 in Rhodobacter sphaeroides 2.4.1

Properties
Regulator type:	Transcription factor
TF locus tag:	RSP_3686
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR2 - Rhodobacterales
Statistics of regulated genes:
- Genes	7
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Rhodobacterales
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -61 Score: 5.3 Sequence: CAGATAAACCAGTTTACTAA Position: -48 Score: 5.7 Sequence: TTACTAAACCGATTTACTTC Locus tag: RSP_3686 Name: rbsR2 Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: RSP_3687 Name: rbsA Funciton: Ribose ABC transporter, periplasmic ribose-binding protein rbsA Locus tag: RSP_3688 Name: rbsB Funciton: Ribose ABC transporter, ATP-binding protein rbsB Locus tag: RSP_3689 Name: rbsC Funciton: Ribose ABC transporter, inner membrane protein rbsC Locus tag: RSP_3690 Name: COG1735 Funciton: phosphotriesterase-like protein Locus tag: RSP_3691 Name: COG5426 Funciton: Uncharacterized membrane protein
	RSP_3686	rbsR2	Transcriptional repressor of ribose utilization, LacI family
	RSP_3687	rbsA	Ribose ABC transporter, periplasmic ribose-binding protein rbsA
	RSP_3688	rbsB	Ribose ABC transporter, ATP-binding protein rbsB
	RSP_3689	rbsC	Ribose ABC transporter, inner membrane protein rbsC
	RSP_3690	COG1735	phosphotriesterase-like protein
	RSP_3691	COG5426	Uncharacterized membrane protein
Position: -70 Score: 6 Sequence: GTTGTAAACCGCTTTACTGA Locus tag: RSP_3695 Name: COG0624 Funciton: Acetylornithine deacetylase (EC 3.5.1.16)
	RSP_3695	COG0624	Acetylornithine deacetylase (EC 3.5.1.16)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD