Regulog RbsR2 - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | repressor |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Proteobacteria/Alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Agrobacterium tumefaciens str. C58 (Cereon) | 6 | 1 |
| Azorhizobium caulinodans ORS 571 | ||
| Bartonella quintana str. Toulouse | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | ||
| Brucella melitensis 16M | ||
| Mesorhizobium loti MAFF303099 | ||
| Mesorhizobium sp. BNC1 | ||
| Nitrobacter winogradskyi Nb-255 | ||
| Rhizobium etli CFN 42 | ||
| Rhizobium leguminosarum bv. viciae 3841 | 9 | 1 |
| Rhizobium sp. NGR234 | ||
| Rhodopseudomonas palustris CGA009 | ||
| Sinorhizobium meliloti 1021 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| rbsR2 |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -86 score = 6.28363 sequence = CTTGTAAACCGGTTTAGTAA Site: position = -73 score = 6.23473 sequence = TTAGTAAATCGCTTTACAAA Gene: Atu3062: Transcriptional repressor of ribose utilization, LacI family |
|
|
|
|
|
|
|
|
|
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -44 score = 6.23737 sequence = CTTGTAAAGCGCTTTACTAA Site: position = -31 score = 5.95978 sequence = TTACTAAACCGCTTTACAAT Gene: pRL90226: Transcriptional repressor of ribose utilization, LacI family |
|
|
|
|
Transcriptional repressor of ribose utilization, LacI family |
| rbsA |
Gene: Atu3063: Ribose ABC transporter, periplasmic ribose-binding protein rbsA |
|
|
|
|
|
Gene: mll7668: Ribose ABC transporter, periplasmic ribose-binding protein rbsA |
|
|
|
Gene: pRL90225: Ribose ABC transporter, periplasmic ribose-binding protein rbsA |
|
|
|
|
Ribose ABC transporter, periplasmic ribose-binding protein rbsA |
| rbsB |
Gene: Atu3064: Ribose ABC transporter, ATP-binding protein rbsB |
|
|
|
|
|
Gene: mll7666: Ribose ABC transporter, ATP-binding protein rbsB |
|
|
|
Gene: pRL90224: Ribose ABC transporter, ATP-binding protein rbsB |
|
|
|
|
Ribose ABC transporter, ATP-binding protein rbsB |
| rbsC |
Gene: Atu3065: Ribose ABC transporter, inner membrane protein rbsC |
|
|
|
|
|
Gene: mll7665: Ribose ABC transporter, inner membrane protein rbsC |
|
|
|
Gene: pRL90223: Ribose ABC transporter, inner membrane protein rbsC |
|
|
|
|
Ribose ABC transporter, inner membrane protein rbsC |
| COG1735 |
Gene: Atu3066: phosphotriesterase-like protein |
|
|
|
|
|
Gene: mll7664: phosphotriesterase-like protein |
|
|
|
Gene: pRL90222: phosphotriesterase-like protein |
|
|
|
|
phosphotriesterase-like protein |
| COG5426 |
Gene: Atu3067: Uncharacterized membrane protein |
|
|
|
|
|
Gene: mll7663: Uncharacterized membrane protein |
|
|
|
Gene: pRL90221: Uncharacterized membrane protein |
|
|
|
|
Uncharacterized membrane protein |
| SSF51366 |
|
|
|
|
|
|
Gene: mll7660: Ribulose-phosphate binding barrel |
|
|
|
Gene: pRL90220: Ribulose-phosphate binding barrel |
|
|
|
|
Ribulose-phosphate binding barrel |
| tenA |
|
|
|
|
|
|
|
|
|
|
Gene: pRL90219: Thiaminase II (EC 3.5.99.2) |
|
|
|
|
Thiaminase II (EC 3.5.99.2) |
| rbsK |
|
|
|
|
|
|
Gene: mll7662: Ribokinase (EC 2.7.1.15) |
|
|
|
Gene: pRL90218: Ribokinase (EC 2.7.1.15) |
|
|
|
|
Ribokinase (EC 2.7.1.15) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |