Regulon of RbsR2 in Rhizobium leguminosarum bv. viciae 3841

Properties
Regulator type:	Transcription factor
TF locus tag:	pRL90226
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR2 - Rhizobiales
Statistics of regulated genes:
- Genes	9
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 6.2 Sequence: CTTGTAAAGCGCTTTACTAA Position: -31 Score: 6 Sequence: TTACTAAACCGCTTTACAAT Locus tag: pRL90226 Name: rbsR2 Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: pRL90225 Name: rbsA Funciton: Ribose ABC transporter, periplasmic ribose-binding protein rbsA Locus tag: pRL90224 Name: rbsB Funciton: Ribose ABC transporter, ATP-binding protein rbsB Locus tag: pRL90223 Name: rbsC Funciton: Ribose ABC transporter, inner membrane protein rbsC Locus tag: pRL90222 Name: COG1735 Funciton: phosphotriesterase-like protein Locus tag: pRL90221 Name: COG5426 Funciton: Uncharacterized membrane protein Locus tag: pRL90220 Name: SSF51366 Funciton: Ribulose-phosphate binding barrel Locus tag: pRL90219 Name: tenA Funciton: Thiaminase II (EC 3.5.99.2) Locus tag: pRL90218 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	pRL90226	rbsR2	Transcriptional repressor of ribose utilization, LacI family
	pRL90225	rbsA	Ribose ABC transporter, periplasmic ribose-binding protein rbsA
	pRL90224	rbsB	Ribose ABC transporter, ATP-binding protein rbsB
	pRL90223	rbsC	Ribose ABC transporter, inner membrane protein rbsC
	pRL90222	COG1735	phosphotriesterase-like protein
	pRL90221	COG5426	Uncharacterized membrane protein
	pRL90220	SSF51366	Ribulose-phosphate binding barrel
	pRL90219	tenA	Thiaminase II (EC 3.5.99.2)
	pRL90218	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD