Regulon of RbsR2 in Agrobacterium tumefaciens str. C58 (Cereon)

Properties
Regulator type:	Transcription factor
TF locus tag:	Atu3062
Regulator family:	LacI
Regulation mode:	repressor
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR2 - Rhizobiales
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -86 Score: 6.3 Sequence: CTTGTAAACCGGTTTAGTAA Position: -73 Score: 6.2 Sequence: TTAGTAAATCGCTTTACAAA Locus tag: Atu3062 Name: rbsR2 Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: Atu3063 Name: rbsA Funciton: Ribose ABC transporter, periplasmic ribose-binding protein rbsA Locus tag: Atu3064 Name: rbsB Funciton: Ribose ABC transporter, ATP-binding protein rbsB Locus tag: Atu3065 Name: rbsC Funciton: Ribose ABC transporter, inner membrane protein rbsC Locus tag: Atu3066 Name: COG1735 Funciton: phosphotriesterase-like protein Locus tag: Atu3067 Name: COG5426 Funciton: Uncharacterized membrane protein
	Atu3062	rbsR2	Transcriptional repressor of ribose utilization, LacI family
	Atu3063	rbsA	Ribose ABC transporter, periplasmic ribose-binding protein rbsA
	Atu3064	rbsB	Ribose ABC transporter, ATP-binding protein rbsB
	Atu3065	rbsC	Ribose ABC transporter, inner membrane protein rbsC
	Atu3066	COG1735	phosphotriesterase-like protein
	Atu3067	COG5426	Uncharacterized membrane protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD