Regulog MntR - Rhodospirillales
| Regulator type: | Transcription factor |
| Regulator family: | DtxR |
| Regulation mode: | repressor |
| Biological process: | Manganese homeostasis |
| Effector: | Manganese ion, (Mn2+) |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - MntR
- By taxonomy - Rhodospirillales
- By TF family - DtxR
- By effector - Manganese ion, (Mn2+)
- By pathway - Manganese homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Rhodospirillum rubrum ATCC 11170 | ||
| Magnetospirillum magnetotacticum MS-1 | ||
| Magnetospirillum magneticum AMB-1 | ||
| Azospirillum sp. B510 | 2 | 2 |
| Rhodospirillum centenum SW | ||
| Gluconacetobacter diazotrophicus PAl 5 | 2 | 2 |
| Acetobacter pasteurianus IFO 3283-01 | 2 | 2 |
| Gluconobacter oxydans 621H | 2 | 2 |
| Granulibacter bethesdensis CGDNIH1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| mntR |
|
|
|
*
Azospirillum sp. B510 Site: position = 16 score = 3.68547 sequence = AGTATGCAAGGCGCTATACT Gene: AZL_b04530: Manganese homeostasis transcriptional regulator MntR, DtxR family |
|
*
Gluconacetobacter diazotrophicus PAl 5 Site: position = -179 score = 5.13522 sequence = AATATGCAATAAGCTATATG Gene: Gdia_1353: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Acetobacter pasteurianus IFO 3283-01 Site: position = -157 score = 5.68271 sequence = AATATGCAATATGCTATATT Site: position = -64 score = 5.5639 sequence = TTTATTCTTTATGGAATATT Gene: APA01_40860: Manganese homeostasis transcriptional regulator MntR, DtxR family |
*
Gluconobacter oxydans 621H Site: position = -140 score = 5.63906 sequence = AATATTCAACATGCTATATT Site: position = -49 score = 4.61587 sequence = TTTATTCCGCCGTGAATAAT Gene: GOX2068: Manganese homeostasis transcriptional regulator MntR, DtxR family |
|
Manganese homeostasis transcriptional regulator MntR, DtxR family |
| CRON 2. | ||||||||||
| mntH |
|
Gene: Magn03007105: Manganese transporter, NRAMP family |
|
*
Azospirillum sp. B510 Site: position = -114 score = 3.68547 sequence = AGTATAGCGCCTTGCATACT Gene: AZL_b04520: Manganese transporter, NRAMP family |
|
*
Gluconacetobacter diazotrophicus PAl 5 Site: position = 16 score = 5.13522 sequence = CATATAGCTTATTGCATATT Gene: Gdia_1352: Manganese transporter, NRAMP family |
*
Acetobacter pasteurianus IFO 3283-01 Site: position = -141 score = 5.5639 sequence = AATATTCCATAAAGAATAAA Site: position = -48 score = 5.68271 sequence = AATATAGCATATTGCATATT Gene: APA01_40840: Manganese transporter, NRAMP family |
*
Gluconobacter oxydans 621H Site: position = -28 score = 5.63906 sequence = AATATAGCATGTTGAATATT Site: position = -119 score = 4.61587 sequence = ATTATTCACGGCGGAATAAA Gene: GOX2067: Manganese transporter, NRAMP family |
|
Manganese transporter, NRAMP family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |