Regulog HrcA - Rhodospirillales
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhodospirillales
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Rhodospirillum rubrum ATCC 11170 | 2 | 1 |
| Magnetospirillum magnetotacticum MS-1 | 2 | 1 |
| Magnetospirillum magneticum AMB-1 | 1 | 1 |
| Azospirillum sp. B510 | 2 | 1 |
| Rhodospirillum centenum SW | 2 | 1 |
| Gluconacetobacter diazotrophicus PAl 5 | 2 | 1 |
| Acetobacter pasteurianus IFO 3283-01 | 2 | 1 |
| Gluconobacter oxydans 621H | 2 | 1 |
| Granulibacter bethesdensis CGDNIH1 | 2 | 1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| groS |
*2
Rhodospirillum rubrum ATCC 11170 Gene: Rru_A0161: Heat shock protein 60 family co-chaperone GroES Site: position = -94 score = 7.38718 sequence = TTAGCACTCGCCGGGTGGGAGTGCTAA Gene: Rru_A0586: Heat shock protein 60 family co-chaperone GroES |
*
Magnetospirillum magnetotacticum MS-1 Site: position = -73 score = 7.26909 sequence = TTGGCACTCGTCGCCGGAGAGTGCTAA Gene: Magn03009934: Heat shock protein 60 family co-chaperone GroES |
|
*
Azospirillum sp. B510 Site: position = -90 score = 7.20853 sequence = CTGGCACTCGCCGGGCGGGAGTGCTAA Gene: AZL_003450: Heat shock protein 60 family co-chaperone GroES |
*
Rhodospirillum centenum SW Site: position = -73 score = 7.27551 sequence = CTGGCACTCACCGCGGGTGAGTGCTAA Gene: RC1_2594: Heat shock protein 60 family co-chaperone GroES |
*2
Gluconacetobacter diazotrophicus PAl 5 Site: position = -109 score = 7.28062 sequence = CTGGCACTCTCGTGCGGAGAGTGCCAA Gene: Gdia_0272: Heat shock protein 60 family co-chaperone GroES Gene: Gdia_0862: Heat shock protein 60 family co-chaperone GroES |
*
Acetobacter pasteurianus IFO 3283-01 Site: position = -41 score = 7.23115 sequence = CTGGCACTCCCGGGGTGGGAGTGCTAA Gene: APA01_17860: Heat shock protein 60 family co-chaperone GroES |
*
Gluconobacter oxydans 621H Site: position = -92 score = 7.12234 sequence = TTGGCACTCTCCATGTGAGAGTGCCAA Gene: GOX1901: Heat shock protein 60 family co-chaperone GroES |
*
Granulibacter bethesdensis CGDNIH1 Site: position = -69 score = 7.32891 sequence = CTGGCACTCCCCGCATGGGAGTGCTAA Gene: GbCGDNIH1_2181: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
2
Rhodospirillum rubrum ATCC 11170 Gene: Rru_A0587: Heat shock protein 60 family chaperone GroEL Gene: Rru_A0162: Heat shock protein 60 family chaperone GroEL |
Gene: Magn03009933: Heat shock protein 60 family chaperone GroEL |
*
Magnetospirillum magneticum AMB-1 Site: position = -388 score = 7.26909 sequence = TTGGCACTCGTCGCCGGAGAGTGCTAA Gene: amb0203: Heat shock protein 60 family chaperone GroEL |
Gene: AZL_003460: Heat shock protein 60 family chaperone GroEL |
Gene: RC1_2595: Heat shock protein 60 family chaperone GroEL |
2
Gluconacetobacter diazotrophicus PAl 5 Gene: Gdia_0861: Heat shock protein 60 family chaperone GroEL Gene: Gdia_0271: Heat shock protein 60 family chaperone GroEL |
Gene: APA01_17870: Heat shock protein 60 family chaperone GroEL |
Gene: GOX1902: Heat shock protein 60 family chaperone GroEL |
Gene: GbCGDNIH1_2180: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |