Regulog HrcA - Ralstonia
| Regulator type: | Transcription factor |
| Regulator family: | HrcA |
| Regulation mode: | repressor |
| Biological process: | Heat shock response |
| Effector: | Heat shock |
| Phylum: | Proteobacteria/beta |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Ralstonia
- By trascription factor - HrcA
- By TF family - HrcA
- By effector - Heat shock
- By pathway - Heat shock response
| Genome | Genes | Operons |
|---|---|---|
| Ralstonia solanacearum GMI1000 | 3 | 2 |
| Ralstonia pickettii 12J | 3 | 2 |
| Ralstonia metallidurans CH34 | 3 | 2 |
| Ralstonia eutropha JMP134 | 3 | 2 |
| Ralstonia eutropha H16 | 3 | 2 |
| Cupriavidus taiwanensis | 3 | 2 |
| Genes | Function | ||||||
|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||
| groS |
*
Ralstonia solanacearum GMI1000 Site: position = -117 score = 7.17411 sequence = TTGGCACTCGCCTGGAGGGAGTGCTAA Gene: RSc0641: Heat shock protein 60 family co-chaperone GroES |
*
Ralstonia pickettii 12J Site: position = -118 score = 7.6448 sequence = TTAGCACTCGCCGGGCAGGAGTGCTAA Gene: Rpic_0578: Heat shock protein 60 family co-chaperone GroES |
*
Ralstonia metallidurans CH34 Site: position = -118 score = 7.56588 sequence = TTAGCACTCGCTGGGGGAGAGTGCTAA Gene: Rmet_0615: Heat shock protein 60 family co-chaperone GroES |
*
Ralstonia eutropha JMP134 Site: position = -130 score = 7.75413 sequence = TTAGCACTCGCTGGGGGTGAGTGCTAA Gene: Reut_A2657: Heat shock protein 60 family co-chaperone GroES |
*
Ralstonia eutropha H16 Site: position = -121 score = 7.81697 sequence = TTAGCACTCGTCAGGGGTGAGTGCTAA Gene: H16_A0705: Heat shock protein 60 family co-chaperone GroES |
*
Cupriavidus taiwanensis Site: position = -121 score = 7.73851 sequence = TTAGCACTCGTCAGGGGGGAGTGCTAA Gene: RALTA_A0685: Heat shock protein 60 family co-chaperone GroES |
Heat shock protein 60 family co-chaperone GroES |
| groL |
Gene: RSc0642: Heat shock protein 60 family chaperone GroEL |
Gene: Rpic_0579: Heat shock protein 60 family chaperone GroEL |
Gene: Rmet_0616: Heat shock protein 60 family chaperone GroEL |
Gene: Reut_A2656: Heat shock protein 60 family chaperone GroEL |
Gene: H16_A0706: Heat shock protein 60 family chaperone GroEL |
Gene: RALTA_A0686: Heat shock protein 60 family chaperone GroEL |
Heat shock protein 60 family chaperone GroEL |
| CRON 2. | |||||||
| rpoH |
*
Ralstonia solanacearum GMI1000 Site: position = -70 score = 7.43468 sequence = TTAGCACTCATCCAGCCGGAGTGCTAA Gene: RSc0374: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Ralstonia pickettii 12J Site: position = -70 score = 7.60832 sequence = TTAGCACTCATCCGGTTGGAGTGCTAA Gene: Rpic_0230: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Ralstonia metallidurans CH34 Site: position = -96 score = 7.65464 sequence = TTAGCACTCGTCCGGTTCGAGTGCTAA Gene: Rmet_0272: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Ralstonia eutropha JMP134 Site: position = -104 score = 7.89102 sequence = TTAGCACTCACCCGGCTTGAGTGCTAA Gene: Reut_A0325: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Ralstonia eutropha H16 Site: position = -104 score = 7.89102 sequence = TTAGCACTCACCCGGCCTGAGTGCTAA Gene: H16_A0354: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
*
Cupriavidus taiwanensis Site: position = -108 score = 7.70278 sequence = TTAGCACTCACCCGGCCAGAGTGCTAA Gene: RALTA_A0299: Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
Heat shock response RNA polymerase sigma factor RpoH (Sigma 32) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |