Regulog CcpN - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | CcpN |
| Regulation mode: | repressor |
| Biological process: | Gluconeogenesis |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - CcpN
- By pathway - Gluconeogenesis
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||
| Lactococcus lactis subsp. lactis Il1403 | ||
| Streptococcus agalactiae 2603V/R | 3 | 1 |
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | 3 | 1 |
| Streptococcus equi subsp. zooepidemicus MGCS10565 | ||
| Streptococcus gallolyticus UCN34 | ||
| Streptococcus gordonii str. Challis substr. CH1 | 4 | 2 |
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | ||
| Streptococcus pneumoniae TIGR4 | ||
| Streptococcus pyogenes M1 GAS | ||
| Streptococcus sanguinis SK36 | 4 | 2 |
| Streptococcus suis 05ZYH33 | ||
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J | 3 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| yqfL |
|
|
*
Streptococcus agalactiae 2603V/R Site: position = -171 score = 5.74187 sequence = ATATAATATAACATATAAAAT Gene: SAG1672: Predicted phosphotransferase |
*
Streptococcus dysgalactiae subsp. equisimilis GGS_124 Site: position = -174 score = 5.41116 sequence = ATATAATGTACCATATATAAT Gene: SDEG_1842: Predicted phosphotransferase |
|
|
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -216 score = 5.72599 sequence = TTAATATGTGTTATATTAAAA Gene: SGO_0811: Predicted phosphotransferase |
|
|
|
|
*
Streptococcus sanguinis SK36 Site: position = -124 score = 5.52902 sequence = TTATAATGTGTTACAAAATGA Gene: SSA_1054: Predicted phosphotransferase |
|
|
*
Streptococcus uberis 0140J Site: position = -44 score = 5.88957 sequence = ATATAATATACTATATAATAA Gene: SUB1521: Predicted phosphotransferase |
Predicted phosphotransferase |
| ccpN |
|
|
Gene: SAG1671: Gluconeogenesis transcriptional regulator CcpN, CcpN family |
Gene: SDEG_1841: Gluconeogenesis transcriptional regulator CcpN, CcpN family |
|
|
Gene: SGO_0812: Gluconeogenesis transcriptional regulator CcpN, CcpN family |
|
|
|
|
Gene: SSA_1055: Gluconeogenesis transcriptional regulator CcpN, CcpN family |
|
|
Gene: SUB1520: Gluconeogenesis transcriptional regulator CcpN, CcpN family |
Gluconeogenesis transcriptional regulator CcpN, CcpN family |
| ppdK |
|
|
Gene: SAG1670: Pyruvate phosphate dikinase (EC 2.7.9.1) |
Gene: SDEG_1840: Pyruvate phosphate dikinase (EC 2.7.9.1) |
|
|
*
Streptococcus gordonii str. Challis substr. CH1 Site: position = -39 score = 5.72599 sequence = TTTTAATATAACACATATTAA Gene: SGO_0810: Pyruvate phosphate dikinase (EC 2.7.9.1) |
|
|
|
|
*
Streptococcus sanguinis SK36 Site: position = -142 score = 5.52902 sequence = TCATTTTGTAACACATTATAA Gene: SSA_1053: Pyruvate phosphate dikinase (EC 2.7.9.1) |
|
|
Gene: SUB1519: Pyruvate phosphate dikinase (EC 2.7.9.1) |
Pyruvate phosphate dikinase (EC 2.7.9.1) |
| fbp |
|
|
|
|
|
|
Gene: SGO_0813: Fructose-1,6-bisphosphatase, Bacillus type (EC 3.1.3.11) |
|
|
|
|
Gene: SSA_1056: Fructose-1,6-bisphosphatase, Bacillus type (EC 3.1.3.11) |
|
|
|
Fructose-1,6-bisphosphatase, Bacillus type (EC 3.1.3.11) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |