Regulon of CcpN in Streptococcus agalactiae 2603V/R

Properties
Regulator type:	Transcription factor
TF locus tag:	SAG1672
Regulator family:	CcpN
Regulation mode:	repressor
Biological process:	Gluconeogenesis
Effector:
Regulog:	CcpN - Streptococcaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CcpN
By pathway - Gluconeogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -171 Score: 5.7 Sequence: ATATAATATAACATATAAAAT Locus tag: SAG1672 Name: yqfL Funciton: Predicted phosphotransferase Locus tag: SAG1671 Name: ccpN Funciton: Gluconeogenesis transcriptional regulator CcpN, CcpN family Locus tag: SAG1670 Name: ppdK Funciton: Pyruvate phosphate dikinase (EC 2.7.9.1)
	SAG1672	yqfL	Predicted phosphotransferase
	SAG1671	ccpN	Gluconeogenesis transcriptional regulator CcpN, CcpN family
	SAG1670	ppdK	Pyruvate phosphate dikinase (EC 2.7.9.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD