Regulon of CcpN in Streptococcus sanguinis SK36

Properties
Regulator type:	Transcription factor
TF locus tag:	SSA_1054
Regulator family:	CcpN
Regulation mode:	repressor
Biological process:	Gluconeogenesis
Effector:
Regulog:	CcpN - Streptococcaceae
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - CcpN
By pathway - Gluconeogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 5.5 Sequence: TTATAATGTGTTACAAAATGA Locus tag: SSA_1054 Name: yqfL Funciton: Predicted phosphotransferase Locus tag: SSA_1055 Name: ccpN Funciton: Gluconeogenesis transcriptional regulator CcpN, CcpN family Locus tag: SSA_1056 Name: fbp Funciton: Fructose-1,6-bisphosphatase, Bacillus type (EC 3.1.3.11)
	SSA_1054	yqfL	Predicted phosphotransferase
	SSA_1055	ccpN	Gluconeogenesis transcriptional regulator CcpN, CcpN family
	SSA_1056	fbp	Fructose-1,6-bisphosphatase, Bacillus type (EC 3.1.3.11)
Position: -142 Score: 5.5 Sequence: TCATTTTGTAACACATTATAA Locus tag: SSA_1053 Name: ppdK Funciton: Pyruvate phosphate dikinase (EC 2.7.9.1)
	SSA_1053	ppdK	Pyruvate phosphate dikinase (EC 2.7.9.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD