Regulog Rcas_3562 - Chloroflexia

Properties
Regulator type:	Transcription factor
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Alpha-galactosides utilization
Effector:
Phylum:	Chloroflexi
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - GntR/Others
By pathway - Alpha-galactosides utilization

Statistics of regulated genes
Genome	Genes	Operons
Chloroflexus aggregans DSM 9485
Chloroflexus sp. Y-400-fl
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941	8	1
Roseiflexus sp. RS-1	8	1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes						Function

CRON 1.
Rcas_3562	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	* Roseiflexus castenholzii DSM 13941 Site: position = -44 score = 7.4345 sequence = TGTCTTATATCCTATGCCATAGGACA Gene: Rcas_3562: Transcriptional regulator, GntR family	* Roseiflexus sp. RS-1 Site: position = -47 score = 7.09512 sequence = TGTCCTGCATCCTATGCAATAAGACA Gene: RoseRS_1355: Transcriptional regulator, GntR family	Transcriptional regulator, GntR family
galZ	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3563: Alpha-galactosidase (EC 3.2.1.22)	Roseiflexus sp. RS-1 Gene: RoseRS_1356: Alpha-galactosidase (EC 3.2.1.22)	Alpha-galactosidase (EC 3.2.1.22)
abcP	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3564: sugar ABC transporter, permease protein	Roseiflexus sp. RS-1 Gene: RoseRS_1357: sugar ABC transporter, permease protein	sugar ABC transporter, permease protein
abcT	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3565: sugar ABC transporter, permease 2	Roseiflexus sp. RS-1 Gene: RoseRS_1358: sugar ABC transporter, permease 2	sugar ABC transporter, permease 2
abcB	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3566: sugar ABC transport system, sugar-binding protein	Roseiflexus sp. RS-1 Gene: RoseRS_1359: sugar ABC transport system, sugar-binding protein	sugar ABC transport system, sugar-binding protein
galY	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3567: Alpha-galactosidase (EC 3.2.1.22)	Roseiflexus sp. RS-1 Gene: RoseRS_1360: Alpha-galactosidase (EC 3.2.1.22)	Alpha-galactosidase (EC 3.2.1.22)
Rcas_3568	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3568: hypothetical protein	Roseiflexus sp. RS-1 Gene: RoseRS_1361: hypothetical protein	hypothetical protein
Rcas_3569	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_3569: Putative oxidoreductase	Roseiflexus sp. RS-1 Gene: RoseRS_1362: Putative oxidoreductase	Putative oxidoreductase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog Rcas_3562 - Chloroflexia

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --