Regulog Rcas_3562 - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Alpha-galactosides utilization |
| Effector: | |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - GntR/Others
- By pathway - Alpha-galactosides utilization
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | ||
| Chloroflexus sp. Y-400-fl | ||
| Herpetosiphon aurantiacus ATCC 23779 | ||
| Roseiflexus castenholzii DSM 13941 | 8 | 1 |
| Roseiflexus sp. RS-1 | 8 | 1 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| Rcas_3562 |
|
|
|
*
Roseiflexus castenholzii DSM 13941 Site: position = -44 score = 7.4345 sequence = TGTCTTATATCCTATGCCATAGGACA Gene: Rcas_3562: Transcriptional regulator, GntR family |
*
Roseiflexus sp. RS-1 Site: position = -47 score = 7.09512 sequence = TGTCCTGCATCCTATGCAATAAGACA Gene: RoseRS_1355: Transcriptional regulator, GntR family |
Transcriptional regulator, GntR family |
| galZ |
|
|
|
Gene: Rcas_3563: Alpha-galactosidase (EC 3.2.1.22) |
Gene: RoseRS_1356: Alpha-galactosidase (EC 3.2.1.22) |
Alpha-galactosidase (EC 3.2.1.22) |
| abcP |
|
|
|
Gene: Rcas_3564: sugar ABC transporter, permease protein |
Gene: RoseRS_1357: sugar ABC transporter, permease protein |
sugar ABC transporter, permease protein |
| abcT |
|
|
|
Gene: Rcas_3565: sugar ABC transporter, permease 2 |
Gene: RoseRS_1358: sugar ABC transporter, permease 2 |
sugar ABC transporter, permease 2 |
| abcB |
|
|
|
Gene: Rcas_3566: sugar ABC transport system, sugar-binding protein |
Gene: RoseRS_1359: sugar ABC transport system, sugar-binding protein |
sugar ABC transport system, sugar-binding protein |
| galY |
|
|
|
Gene: Rcas_3567: Alpha-galactosidase (EC 3.2.1.22) |
Gene: RoseRS_1360: Alpha-galactosidase (EC 3.2.1.22) |
Alpha-galactosidase (EC 3.2.1.22) |
| Rcas_3568 |
|
|
|
Gene: Rcas_3568: hypothetical protein |
Gene: RoseRS_1361: hypothetical protein |
hypothetical protein |
| Rcas_3569 |
|
|
|
Gene: Rcas_3569: Putative oxidoreductase |
Gene: RoseRS_1362: Putative oxidoreductase |
Putative oxidoreductase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |