Regulon of Rcas_3562 in Roseiflexus castenholzii DSM 13941

Properties
Regulator type:	Transcription factor
TF locus tag:	Rcas_3562
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Alpha-galactosides utilization
Effector:
Regulog:	Rcas_3562 - Chloroflexia
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - GntR/Others
By pathway - Alpha-galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -44 Score: 7.4 Sequence: TGTCTTATATCCTATGCCATAGGACA Locus tag: Rcas_3562 Name: Rcas_3562 Funciton: Transcriptional regulator, GntR family Locus tag: Rcas_3563 Name: galZ Funciton: Alpha-galactosidase (EC 3.2.1.22) Locus tag: Rcas_3564 Name: abcP Funciton: sugar ABC transporter, permease protein Locus tag: Rcas_3565 Name: abcT Funciton: sugar ABC transporter, permease 2 Locus tag: Rcas_3566 Name: abcB Funciton: sugar ABC transport system, sugar-binding protein Locus tag: Rcas_3567 Name: galY Funciton: Alpha-galactosidase (EC 3.2.1.22) Locus tag: Rcas_3568 Name: Rcas_3568 Funciton: hypothetical protein Locus tag: Rcas_3569 Name: Rcas_3569 Funciton: Putative oxidoreductase
	Rcas_3562	Rcas_3562	Transcriptional regulator, GntR family
	Rcas_3563	galZ	Alpha-galactosidase (EC 3.2.1.22)
	Rcas_3564	abcP	sugar ABC transporter, permease protein
	Rcas_3565	abcT	sugar ABC transporter, permease 2
	Rcas_3566	abcB	sugar ABC transport system, sugar-binding protein
	Rcas_3567	galY	Alpha-galactosidase (EC 3.2.1.22)
	Rcas_3568	Rcas_3568	hypothetical protein
	Rcas_3569	Rcas_3569	Putative oxidoreductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD