Regulon of Rcas_3562 in Roseiflexus sp. RS-1

Properties
Regulator type:	Transcription factor
TF locus tag:	RoseRS_1355
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Alpha-galactosides utilization
Effector:
Regulog:	Rcas_3562 - Chloroflexia
Statistics of regulated genes:
- Genes	8
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - GntR/Others
By pathway - Alpha-galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -47 Score: 7.1 Sequence: TGTCCTGCATCCTATGCAATAAGACA Locus tag: RoseRS_1355 Name: Rcas_3562 Funciton: Transcriptional regulator, GntR family Locus tag: RoseRS_1356 Name: galZ Funciton: Alpha-galactosidase (EC 3.2.1.22) Locus tag: RoseRS_1357 Name: abcP Funciton: sugar ABC transporter, permease protein Locus tag: RoseRS_1358 Name: abcT Funciton: sugar ABC transporter, permease 2 Locus tag: RoseRS_1359 Name: abcB Funciton: sugar ABC transport system, sugar-binding protein Locus tag: RoseRS_1360 Name: galY Funciton: Alpha-galactosidase (EC 3.2.1.22) Locus tag: RoseRS_1361 Name: Rcas_3568 Funciton: hypothetical protein Locus tag: RoseRS_1362 Name: Rcas_3569 Funciton: Putative oxidoreductase
	RoseRS_1355	Rcas_3562	Transcriptional regulator, GntR family
	RoseRS_1356	galZ	Alpha-galactosidase (EC 3.2.1.22)
	RoseRS_1357	abcP	sugar ABC transporter, permease protein
	RoseRS_1358	abcT	sugar ABC transporter, permease 2
	RoseRS_1359	abcB	sugar ABC transport system, sugar-binding protein
	RoseRS_1360	galY	Alpha-galactosidase (EC 3.2.1.22)
	RoseRS_1361	Rcas_3568	hypothetical protein
	RoseRS_1362	Rcas_3569	Putative oxidoreductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD