Regulog PadR - Streptococcaceae

Properties
Regulator type:	Transcription factor
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Phenolic acid stress response
Effector:	Ferulic acid; p-Coumaric acid
Phylum:	Firmicutes
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - PadR
By effector - Ferulic acid
By effector - p-Coumaric acid
By pathway - Phenolic acid stress response

Statistics of regulated genes
Genome	Genes	Operons
Lactococcus lactis subsp. cremoris SK11
Lactococcus lactis subsp. lactis Il1403	1	1
Streptococcus agalactiae 2603V/R
Streptococcus dysgalactiae subsp. equisimilis GGS_124
Streptococcus equi subsp. zooepidemicus MGCS10565
Streptococcus gallolyticus UCN34	2	1
Streptococcus gordonii str. Challis substr. CH1
Streptococcus mitis B6
Streptococcus mutans UA159
Streptococcus pneumoniae TIGR4
Streptococcus pyogenes M1 GAS
Streptococcus sanguinis SK36
Streptococcus suis 05ZYH33
Streptococcus thermophilus CNRZ1066
Streptococcus uberis 0140J

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
padC	Lactococcus lactis subsp. cremoris SK11	* Lactococcus lactis subsp. lactis Il1403 Site: position = 4 score = 6.53152 sequence = AAACATTTAAAAGCTTAGAAGATT Gene: L193734: Phenolic acid decarboxylase (EC 4.1.1.-)	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	* Streptococcus gallolyticus UCN34 Site: position = 7 score = 6.42992 sequence = AAACATTTAAAACTTTGGACGATT Gene: GALLO_2106: Phenolic acid decarboxylase (EC 4.1.1.-)	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Phenolic acid decarboxylase (EC 4.1.1.-)
padR	Lactococcus lactis subsp. cremoris SK11 Gene: LACR_2204: Phenolic acid stress response transcriptional regulator PadR, PadR family	Lactococcus lactis subsp. lactis Il1403 Gene: L9255: Phenolic acid stress response transcriptional regulator PadR, PadR family	Streptococcus agalactiae 2603V/R	Streptococcus dysgalactiae subsp. equisimilis GGS_124	Streptococcus equi subsp. zooepidemicus MGCS10565	Streptococcus gallolyticus UCN34 Gene: GALLO_2107: Phenolic acid stress response transcriptional regulator PadR, PadR family	Streptococcus gordonii str. Challis substr. CH1	Streptococcus mitis B6	Streptococcus mutans UA159	Streptococcus pneumoniae TIGR4	Streptococcus pyogenes M1 GAS	Streptococcus sanguinis SK36	Streptococcus suis 05ZYH33 Gene: SSU05_1630: Phenolic acid stress response transcriptional regulator PadR, PadR family	Streptococcus thermophilus CNRZ1066	Streptococcus uberis 0140J	Phenolic acid stress response transcriptional regulator PadR, PadR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog PadR - Streptococcaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --