Regulog PadR - Streptococcaceae
| Regulator type: | Transcription factor |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Phenolic acid stress response |
| Effector: | Ferulic acid; p-Coumaric acid |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - PadR
- By effector - Ferulic acid
- By effector - p-Coumaric acid
- By pathway - Phenolic acid stress response
| Genome | Genes | Operons |
|---|---|---|
| Lactococcus lactis subsp. cremoris SK11 | ||
| Lactococcus lactis subsp. lactis Il1403 | 1 | 1 |
| Streptococcus agalactiae 2603V/R | ||
| Streptococcus dysgalactiae subsp. equisimilis GGS_124 | ||
| Streptococcus equi subsp. zooepidemicus MGCS10565 | ||
| Streptococcus gallolyticus UCN34 | 2 | 1 |
| Streptococcus gordonii str. Challis substr. CH1 | ||
| Streptococcus mitis B6 | ||
| Streptococcus mutans UA159 | ||
| Streptococcus pneumoniae TIGR4 | ||
| Streptococcus pyogenes M1 GAS | ||
| Streptococcus sanguinis SK36 | ||
| Streptococcus suis 05ZYH33 | ||
| Streptococcus thermophilus CNRZ1066 | ||
| Streptococcus uberis 0140J |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| padC |
|
*
Lactococcus lactis subsp. lactis Il1403 Site: position = 4 score = 6.53152 sequence = AAACATTTAAAAGCTTAGAAGATT Gene: L193734: Phenolic acid decarboxylase (EC 4.1.1.-) |
|
|
|
*
Streptococcus gallolyticus UCN34 Site: position = 7 score = 6.42992 sequence = AAACATTTAAAACTTTGGACGATT Gene: GALLO_2106: Phenolic acid decarboxylase (EC 4.1.1.-) |
|
|
|
|
|
|
|
|
|
Phenolic acid decarboxylase (EC 4.1.1.-) |
| padR |
Gene: LACR_2204: Phenolic acid stress response transcriptional regulator PadR, PadR family |
Gene: L9255: Phenolic acid stress response transcriptional regulator PadR, PadR family |
|
|
|
Gene: GALLO_2107: Phenolic acid stress response transcriptional regulator PadR, PadR family |
|
|
|
|
|
|
Gene: SSU05_1630: Phenolic acid stress response transcriptional regulator PadR, PadR family |
|
|
Phenolic acid stress response transcriptional regulator PadR, PadR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |