Regulon of PadR in Lactococcus lactis subsp. lactis Il1403
Regulator type: | Transcription factor |
TF locus tag: | L9255 |
Regulator family: | PadR |
Regulation mode: | repressor |
Biological process: | Phenolic acid stress response |
Effector: | Ferulic acid; p-Coumaric acid |
Regulog: | PadR - Streptococcaceae |
Statistics of regulated genes: | |
- Genes | 1 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Streptococcaceae
- By TF family - PadR
- By effector - Ferulic acid
- By effector - p-Coumaric acid
- By pathway - Phenolic acid stress response
Locus Tag | Name | Function | |
---|---|---|---|
Position: 4
Score: 6.5 Sequence: AAACATTTAAAAGCTTAGAAGATT
Locus tag: L193734
Name: padC Funciton: Phenolic acid decarboxylase (EC 4.1.1.-) |
|||
padC
|
Phenolic acid decarboxylase (EC 4.1.1.-)
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |