Regulon of PadR in Lactococcus lactis subsp. lactis Il1403

Properties
Regulator type:	Transcription factor
TF locus tag:	L9255
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Phenolic acid stress response
Effector:	Ferulic acid; p-Coumaric acid
Regulog:	PadR - Streptococcaceae
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - PadR
By effector - Ferulic acid
By effector - p-Coumaric acid
By pathway - Phenolic acid stress response

Regulated operons
	Locus Tag	Name	Function
Position: 4 Score: 6.5 Sequence: AAACATTTAAAAGCTTAGAAGATT Locus tag: L193734 Name: padC Funciton: Phenolic acid decarboxylase (EC 4.1.1.-)
	L193734	padC	Phenolic acid decarboxylase (EC 4.1.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD