Regulon of PadR in Streptococcus gallolyticus UCN34

Properties
Regulator type:	Transcription factor
TF locus tag:	GALLO_2107
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Phenolic acid stress response
Effector:	Ferulic acid; p-Coumaric acid
Regulog:	PadR - Streptococcaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Streptococcaceae
By TF family - PadR
By effector - Ferulic acid
By effector - p-Coumaric acid
By pathway - Phenolic acid stress response

Regulated operons
	Locus Tag	Name	Function
Position: 7 Score: 6.4 Sequence: AAACATTTAAAACTTTGGACGATT Locus tag: GALLO_2106 Name: padC Funciton: Phenolic acid decarboxylase (EC 4.1.1.-) Locus tag: GALLO_2107 Name: padR Funciton: Phenolic acid stress response transcriptional regulator PadR, PadR family
	GALLO_2106	padC	Phenolic acid decarboxylase (EC 4.1.1.-)
	GALLO_2107	padR	Phenolic acid stress response transcriptional regulator PadR, PadR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD