Regulog RutR4 - Pseudomonadaceae
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Azotobacter vinelandii AvOP | ||
| Cellvibrio japonicus Ueda107 | ||
| Pseudomonas aeruginosa PAO1 | ||
| Pseudomonas entomophila L48 | ||
| Pseudomonas fluorescens Pf-5 | ||
| Pseudomonas mendocina ymp | ||
| Pseudomonas putida KT2440 | ||
| Pseudomonas stutzeri A1501 | 7 | 2 |
| Pseudomonas syringae pv. tomato str. DC3000 | 6 | 2 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| rutR4 |
|
|
|
|
|
|
|
*
Pseudomonas stutzeri A1501 Site: position = -156 score = 6.03842 sequence = TGTGGACCATTTGGTCCGAA Gene: PST_3596: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -214 score = 5.79496 sequence = AGCAGACCATTTGGTCTGAA Gene: PSPTO1158: Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
Transcriptional regulator RutR of pyrimidine catabolism, TetR family |
| CRON 2. | ||||||||||
| rutA |
|
|
|
|
|
|
|
*
Pseudomonas stutzeri A1501 Site: position = -157 score = 6.03842 sequence = TTCGGACCAAATGGTCCACA Gene: PST_3597: Pyrimidine oxygenase |
*
Pseudomonas syringae pv. tomato str. DC3000 Site: position = -68 score = 5.79496 sequence = TTCAGACCAAATGGTCTGCT Gene: PSPTO1157: Pyrimidine oxygenase |
Pyrimidine oxygenase |
| rutB |
|
|
|
|
|
|
|
Gene: PST_3598: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
Gene: PSPTO1156: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
| rutC |
|
|
|
|
|
|
|
Gene: PST_3599: Aminoacrylate peracid reductase |
Gene: PSPTO1155: Aminoacrylate peracid reductase |
Aminoacrylate peracid reductase |
| rutD |
|
|
|
|
|
|
|
Gene: PST_3600: Aminoacrylate hydrolase |
Gene: PSPTO1154: Aminoacrylate hydrolase |
Aminoacrylate hydrolase |
| rutE |
|
|
|
|
|
|
|
Gene: PST_3601: 3-hydroxy propionic acid dehydrogenase |
|
3-hydroxy propionic acid dehydrogenase |
| rutF |
|
|
|
|
|
|
|
Gene: PST_3602: Flavin reductase |
Gene: PSPTO1153: Flavin reductase |
Flavin reductase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |