Regulog RutR4 - Pseudomonadaceae

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Phylum:	Proteobacteria/gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By trascription factor - RutR
By TF family - TetR
By effector - Uracil
By pathway - Pyrimidine utilization

Statistics of regulated genes
Genome	Genes	Operons
Azotobacter vinelandii AvOP
Cellvibrio japonicus Ueda107
Pseudomonas aeruginosa PAO1
Pseudomonas entomophila L48
Pseudomonas fluorescens Pf-5
Pseudomonas mendocina ymp
Pseudomonas putida KT2440
Pseudomonas stutzeri A1501	7	2
Pseudomonas syringae pv. tomato str. DC3000	6	2

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
rutR4	Azotobacter vinelandii AvOP	Cellvibrio japonicus Ueda107	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	* Pseudomonas stutzeri A1501 Site: position = -156 score = 6.03842 sequence = TGTGGACCATTTGGTCCGAA Gene: PST_3596: Transcriptional regulator RutR of pyrimidine catabolism, TetR family	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -214 score = 5.79496 sequence = AGCAGACCATTTGGTCTGAA Gene: PSPTO1158: Transcriptional regulator RutR of pyrimidine catabolism, TetR family	Transcriptional regulator RutR of pyrimidine catabolism, TetR family

CRON 2.
rutA	Azotobacter vinelandii AvOP	Cellvibrio japonicus Ueda107	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	* Pseudomonas stutzeri A1501 Site: position = -157 score = 6.03842 sequence = TTCGGACCAAATGGTCCACA Gene: PST_3597: Pyrimidine oxygenase	* Pseudomonas syringae pv. tomato str. DC3000 Site: position = -68 score = 5.79496 sequence = TTCAGACCAAATGGTCTGCT Gene: PSPTO1157: Pyrimidine oxygenase	Pyrimidine oxygenase
rutB	Azotobacter vinelandii AvOP	Cellvibrio japonicus Ueda107	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501 Gene: PST_3598: Peroxyureidoacrylate / ureidoacrylate amido hydrolase	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1156: Peroxyureidoacrylate / ureidoacrylate amido hydrolase	Peroxyureidoacrylate / ureidoacrylate amido hydrolase
rutC	Azotobacter vinelandii AvOP	Cellvibrio japonicus Ueda107	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501 Gene: PST_3599: Aminoacrylate peracid reductase	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1155: Aminoacrylate peracid reductase	Aminoacrylate peracid reductase
rutD	Azotobacter vinelandii AvOP	Cellvibrio japonicus Ueda107	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501 Gene: PST_3600: Aminoacrylate hydrolase	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1154: Aminoacrylate hydrolase	Aminoacrylate hydrolase
rutE	Azotobacter vinelandii AvOP	Cellvibrio japonicus Ueda107	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501 Gene: PST_3601: 3-hydroxy propionic acid dehydrogenase	Pseudomonas syringae pv. tomato str. DC3000	3-hydroxy propionic acid dehydrogenase
rutF	Azotobacter vinelandii AvOP	Cellvibrio japonicus Ueda107	Pseudomonas aeruginosa PAO1	Pseudomonas entomophila L48	Pseudomonas fluorescens Pf-5	Pseudomonas mendocina ymp	Pseudomonas putida KT2440	Pseudomonas stutzeri A1501 Gene: PST_3602: Flavin reductase	Pseudomonas syringae pv. tomato str. DC3000 Gene: PSPTO1153: Flavin reductase	Flavin reductase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog RutR4 - Pseudomonadaceae

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --