Regulog ModR - Chloroflexia
| Regulator type: | Transcription factor |
| Regulator family: | PadR |
| Regulation mode: | repressor |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Chloroflexi |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Chloroflexi
- By TF family - PadR
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Chloroflexus aggregans DSM 9485 | 5 | 1 |
| Chloroflexus sp. Y-400-fl | 6 | 2 |
| Herpetosiphon aurantiacus ATCC 23779 | ||
| Roseiflexus castenholzii DSM 13941 | 1 | 1 |
| Roseiflexus sp. RS-1 |
| Genes | Function | |||||
|---|---|---|---|---|---|---|
| CRON 1. | ||||||
| Cagg_1452 |
Gene: Cagg_1452: oxidoreductase molybdopterin binding |
*
Chloroflexus sp. Y-400-fl Site: position = -166 score = 6.87022 sequence = AGTATTCACAATGTGAATACT Gene: Chy400_2684: oxidoreductase molybdopterin binding |
|
|
|
oxidoreductase molybdopterin binding |
| CRON 2. | ||||||
| modR |
*
Chloroflexus aggregans DSM 9485 Site: position = -82 score = 6.10895 sequence = AGTACTCACATCGTGAATATA Gene: Cagg_1371: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family |
*
Chloroflexus sp. Y-400-fl Site: position = -102 score = 6.87022 sequence = AGTATTCACATTGTGAATACT Gene: Chy400_2685: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family |
|
*
Roseiflexus castenholzii DSM 13941 Site: position = -27 score = 5.31354 sequence = TATATTTATTTTTTGAATAGT Gene: Rcas_2179: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family |
|
Predicted transcriptional regulator of molybdate homeostasis, PadR-like family |
| modA |
Gene: Cagg_1370: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1) |
Gene: Chy400_2686: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1) |
|
Gene: Rcas_2178: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1) |
Gene: RoseRS_1798: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1) |
Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1) |
| modB |
Gene: Cagg_1369: Molybdate transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: Chy400_2687: Molybdate transport system permease protein ModB (TC 3.A.1.8.1) |
|
Gene: Rcas_2177: Molybdate transport system permease protein ModB (TC 3.A.1.8.1) |
Gene: RoseRS_1797: Molybdate transport system permease protein ModB (TC 3.A.1.8.1) |
Molybdate transport system permease protein ModB (TC 3.A.1.8.1) |
| modC |
Gene: Cagg_1368: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1) |
|
|
Gene: Rcas_2176: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Gene: RoseRS_1796: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1) |
Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1) |
| Cagg_1367 |
Gene: Cagg_1367: Metal-dependent hydrolase |
Gene: Chy400_2689: Metal-dependent hydrolase |
|
Gene: Rcas_0130: Metal-dependent hydrolase |
Gene: RoseRS_4339: Metal-dependent hydrolase |
Metal-dependent hydrolase |
| Chy400_2688 |
|
Gene: Chy400_2688: ABC transporter related |
|
|
|
ABC transporter related |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |