Statistics of regulated genes

Genome	Genes	Operons
Chloroflexus aggregans DSM 9485	5	1
Chloroflexus sp. Y-400-fl	6	2
Herpetosiphon aurantiacus ATCC 23779
Roseiflexus castenholzii DSM 13941	1	1
Roseiflexus sp. RS-1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes						Function
CRON 1.
Cagg_1452	Chloroflexus aggregans DSM 9485 Gene: Cagg_1452: oxidoreductase molybdopterin binding	* Chloroflexus sp. Y-400-fl Site: position = -166 score = 6.87022 sequence = AGTATTCACAATGTGAATACT Gene: Chy400_2684: oxidoreductase molybdopterin binding	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	oxidoreductase molybdopterin binding
CRON 2.
modR	* Chloroflexus aggregans DSM 9485 Site: position = -82 score = 6.10895 sequence = AGTACTCACATCGTGAATATA Gene: Cagg_1371: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family	* Chloroflexus sp. Y-400-fl Site: position = -102 score = 6.87022 sequence = AGTATTCACATTGTGAATACT Gene: Chy400_2685: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family	Herpetosiphon aurantiacus ATCC 23779	* Roseiflexus castenholzii DSM 13941 Site: position = -27 score = 5.31354 sequence = TATATTTATTTTTTGAATAGT Gene: Rcas_2179: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family	Roseiflexus sp. RS-1	Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
modA	Chloroflexus aggregans DSM 9485 Gene: Cagg_1370: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)	Chloroflexus sp. Y-400-fl Gene: Chy400_2686: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_2178: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)	Roseiflexus sp. RS-1 Gene: RoseRS_1798: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)	Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
modB	Chloroflexus aggregans DSM 9485 Gene: Cagg_1369: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)	Chloroflexus sp. Y-400-fl Gene: Chy400_2687: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_2177: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)	Roseiflexus sp. RS-1 Gene: RoseRS_1797: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)	Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
modC	Chloroflexus aggregans DSM 9485 Gene: Cagg_1368: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)	Chloroflexus sp. Y-400-fl	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_2176: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)	Roseiflexus sp. RS-1 Gene: RoseRS_1796: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)	Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)
Cagg_1367	Chloroflexus aggregans DSM 9485 Gene: Cagg_1367: Metal-dependent hydrolase	Chloroflexus sp. Y-400-fl Gene: Chy400_2689: Metal-dependent hydrolase	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941 Gene: Rcas_0130: Metal-dependent hydrolase	Roseiflexus sp. RS-1 Gene: RoseRS_4339: Metal-dependent hydrolase	Metal-dependent hydrolase
Chy400_2688	Chloroflexus aggregans DSM 9485	Chloroflexus sp. Y-400-fl Gene: Chy400_2688: ABC transporter related	Herpetosiphon aurantiacus ATCC 23779	Roseiflexus castenholzii DSM 13941	Roseiflexus sp. RS-1	ABC transporter related

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD