Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Orthologous regulated operons containing Chy400_2688 gene

Properties
Regulog: ModR - Chloroflexia
Regulator type: Transcription factor
Regulator family: PadR
Regulation mode: repressor
Biological process: Molybdenum homeostasis
Effector: Molybdate
Phylum: Chloroflexi
Built upon 4 sites [see more]
Orthologous operons
Operon Position Score Sequence Locus Tag of the First Gene
Chloroflexus sp. Y-400-fl
Position: -102
Score: 6.87022
Sequence: AGTATTCACATTGTGAATACT
Locus tag: Chy400_2685
Name: modR
Funciton: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
Locus tag: Chy400_2686
Name: modA
Funciton: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
Locus tag: Chy400_2687
Name: modB
Funciton: Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
Locus tag: Chy400_2688
Name: null
Funciton: ABC transporter related
Locus tag: Chy400_2689
Name: Cagg_1367
Funciton: Metal-dependent hydrolase
modR-modA-modB-Chy400_2688-Cagg_1367 -102 6.9 AGTATTCACATTGTGAATACT Chy400_2685