Regulon of ModR in Chloroflexus aggregans DSM 9485

Properties
Regulator type:	Transcription factor
TF locus tag:	Cagg_1371
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModR - Chloroflexia
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - PadR
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -82 Score: 6.1 Sequence: AGTACTCACATCGTGAATATA Locus tag: Cagg_1371 Name: modR Funciton: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family Locus tag: Cagg_1370 Name: modA Funciton: Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1) Locus tag: Cagg_1369 Name: modB Funciton: Molybdate transport system permease protein ModB (TC 3.A.1.8.1) Locus tag: Cagg_1368 Name: modC Funciton: Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1) Locus tag: Cagg_1367 Name: Cagg_1367 Funciton: Metal-dependent hydrolase
	Cagg_1371	modR	Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
	Cagg_1370	modA	Molybdate ABC transporter, periplasmic binding protein ModA (TC 3.A.1.8.1)
	Cagg_1369	modB	Molybdate transport system permease protein ModB (TC 3.A.1.8.1)
	Cagg_1368	modC	Molybdate transport ATP-binding protein ModC (TC 3.A.1.8.1)
	Cagg_1367	Cagg_1367	Metal-dependent hydrolase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD