Regulon of ModR in Roseiflexus castenholzii DSM 13941

Properties
Regulator type:	Transcription factor
TF locus tag:	Rcas_2179
Regulator family:	PadR
Regulation mode:	repressor
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModR - Chloroflexia
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Chloroflexi
By TF family - PadR
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -27 Score: 5.3 Sequence: TATATTTATTTTTTGAATAGT Locus tag: Rcas_2179 Name: modR Funciton: Predicted transcriptional regulator of molybdate homeostasis, PadR-like family
	Rcas_2179	modR	Predicted transcriptional regulator of molybdate homeostasis, PadR-like family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD