Regulog YvbF/YvaV - Bacillales

Member of regulog collections
- By taxonomy - Bacillales
- By TF family - MarR
- By pathway - Osmotic stress response
Genome | Genes | Operons |
---|---|---|
Anoxybacillus flavithermus WK1 | ||
Bacillus amyloliquefaciens FZB42 | 10 | 4 |
Bacillus cereus ATCC 14579 | ||
Bacillus clausii KSM-K16 | ||
Bacillus halodurans C-125 | ||
Bacillus licheniformis DSM 13 | 5 | 2 |
Bacillus pumilus SAFR-032 | 5 | 2 |
Bacillus subtilis subsp. subtilis str. 168 | 10 | 4 |
Geobacillus kaustophilus HTA426 | ||
Oceanobacillus iheyensis HTE831 | ||
Paenibacillus sp. JDR-2 |
Genes | Function | |||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | ||||||||||||
opuCA |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -111 score = 7.83843 sequence = TAAACTTTTTAATTTACAAAGTTTA Gene: RBAM_031050: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA |
|
Gene: ABC3029: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA |
|
*
Bacillus licheniformis DSM 13 Site: position = -79 score = 7.49372 sequence = TAAACTTTTTATTTTACAAAGTGTA Gene: BLi03651: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA |
*
Bacillus pumilus SAFR-032 Site: position = -89 score = 7.35048 sequence = TAAACTTTTTATTTTATAAAGTTTG Gene: BPUM_3043: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -85 score = 7.49372 sequence = TAAACTTTTTATTTTACAAAGTTCA Gene: BSU33830: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA |
|
|
Gene: Pjdr2_1633: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA |
Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA |
opuCB |
|
Gene: RBAM_031040: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB |
|
Gene: ABC3030: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB |
|
Gene: BLi03650: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB |
Gene: BPUM_3042: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB |
Gene: BSU33820: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB |
|
|
Gene: Pjdr2_1634: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB |
Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB |
opuCC |
|
Gene: RBAM_031030: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein |
|
Gene: ABC3031: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein |
|
Gene: BLi03649: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein |
Gene: BPUM_3041: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein |
Gene: BSU33810: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein |
|
|
Gene: Pjdr2_1635: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein |
Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein |
opuCD |
|
Gene: RBAM_031020: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD |
|
Gene: ABC3032: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD |
|
Gene: BLi03648: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD |
Gene: BPUM_3040: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD |
Gene: BSU33800: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD |
|
|
Gene: Pjdr2_1636: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD |
Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD |
CRON 2. | ||||||||||||
yvaV |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -199 score = 7.83843 sequence = TAAACTTTGTAAATTAAAAAGTTTA Gene: RBAM_031060: Transcriptional regulator of choline transport, MarR family |
|
Gene: ABC1772: Transcriptional regulator of choline transport, MarR family |
|
*
Bacillus licheniformis DSM 13 Site: position = -203 score = 7.49372 sequence = TACACTTTGTAAAATAAAAAGTTTA Gene: BLi03652: Transcriptional regulator of choline transport, MarR family |
*
Bacillus pumilus SAFR-032 Site: position = -205 score = 7.35048 sequence = CAAACTTTATAAAATAAAAAGTTTA Gene: BPUM_3044: Transcriptional regulator of choline transport, MarR family |
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -198 score = 7.13209 sequence = TAAAGTTTATAAAATAAAAAGTTTA Gene: BSU33740: Transcriptional regulator of choline transport, MarR family |
|
|
|
Transcriptional regulator of choline transport, MarR family |
CRON 3. | ||||||||||||
yvbF |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -201 score = 7.00573 sequence = TGAAATTTGTAAAATAAAAAGTTTA Gene: RBAM_031110: Transcriptional regulator of choline transport, MarR family |
|
|
|
|
|
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -203 score = 7.49372 sequence = TGAACTTTGTAAAATAAAAAGTTTA Gene: BSU33840: Transcriptional regulator of choline transport, MarR family |
|
|
|
Transcriptional regulator of choline transport, MarR family |
CRON 4. | ||||||||||||
opuBA |
|
*
Bacillus amyloliquefaciens FZB42 Site: position = -111 score = 7.83843 sequence = TAAACTTTTTAATTTACAAAGTTTA Gene: RBAM_031050: Osmotically activated choline ABC transporter, ATP-binding protein OpuBA |
|
|
|
|
|
*
Bacillus subtilis subsp. subtilis str. 168 Site: position = -110 score = 7.13209 sequence = TAAACTTTTTATTTTATAAACTTTA Gene: BSU33730: Osmotically activated choline ABC transporter, ATP-binding protein OpuBA |
|
|
|
Osmotically activated choline ABC transporter, ATP-binding protein OpuBA |
opuBB |
|
Gene: RBAM_031040: Osmotically activated choline ABC transporter, permease protein OpuBB |
|
|
|
|
|
Gene: BSU33720: Osmotically activated choline ABC transporter, permease protein OpuBB |
|
|
|
Osmotically activated choline ABC transporter, permease protein OpuBB |
opuBC |
|
Gene: RBAM_031030: Osmotically activated choline ABC transporter, substrate-binding protein OpuBC |
|
|
|
|
|
Gene: BSU33710: Osmotically activated choline ABC transporter, substrate-binding protein OpuBC |
|
|
|
Osmotically activated choline ABC transporter, substrate-binding protein OpuBC |
opuBD |
|
Gene: RBAM_031020: Osmotically activated choline ABC transporter, permease protein OpuBB |
|
|
|
|
|
Gene: BSU33700: Osmotically activated choline ABC transporter, permease protein OpuBB |
|
|
|
Osmotically activated choline ABC transporter, permease protein OpuBB |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |