Regulon of YvbF/YvaV in Bacillus amyloliquefaciens FZB42

Properties
Regulator type:	Transcription factor
TF locus tag:	RBAM_031060, RBAM_031110
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Osmotic stress response
Effector:
Regulog:	YvbF/YvaV - Bacillales
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MarR
By pathway - Osmotic stress response

Regulated operons
	Locus Tag	Name	Function
Position: -111 Score: 7.8 Sequence: TAAACTTTTTAATTTACAAAGTTTA Locus tag: RBAM_031050 Name: opuCA Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA Locus tag: RBAM_031040 Name: opuCB Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB Locus tag: RBAM_031030 Name: opuCC Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein Locus tag: RBAM_031020 Name: opuCD Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD
	RBAM_031050	opuCA	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA
	RBAM_031040	opuCB	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB
	RBAM_031030	opuCC	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein
	RBAM_031020	opuCD	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD
Position: -201 Score: 7 Sequence: TGAAATTTGTAAAATAAAAAGTTTA Locus tag: RBAM_031110 Name: yvbF Funciton: Transcriptional regulator of choline transport, MarR family
	RBAM_031110	yvbF	Transcriptional regulator of choline transport, MarR family
Position: -199 Score: 7.8 Sequence: TAAACTTTGTAAATTAAAAAGTTTA Locus tag: RBAM_031060 Name: yvaV Funciton: Transcriptional regulator of choline transport, MarR family
	RBAM_031060	yvaV	Transcriptional regulator of choline transport, MarR family
Position: -111 Score: 7.8 Sequence: TAAACTTTTTAATTTACAAAGTTTA Locus tag: RBAM_031050 Name: opuBA Funciton: Osmotically activated choline ABC transporter, ATP-binding protein OpuBA Locus tag: RBAM_031040 Name: opuBB Funciton: Osmotically activated choline ABC transporter, permease protein OpuBB Locus tag: RBAM_031030 Name: opuBC Funciton: Osmotically activated choline ABC transporter, substrate-binding protein OpuBC Locus tag: RBAM_031020 Name: opuBD Funciton: Osmotically activated choline ABC transporter, permease protein OpuBB
	RBAM_031050	opuBA	Osmotically activated choline ABC transporter, ATP-binding protein OpuBA
	RBAM_031040	opuBB	Osmotically activated choline ABC transporter, permease protein OpuBB
	RBAM_031030	opuBC	Osmotically activated choline ABC transporter, substrate-binding protein OpuBC
	RBAM_031020	opuBD	Osmotically activated choline ABC transporter, permease protein OpuBB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD