Regulon of YvbF/YvaV in Bacillus pumilus SAFR-032

Properties
Regulator type:	Transcription factor
TF locus tag:	BPUM_3044
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Osmotic stress response
Effector:
Regulog:	YvbF/YvaV - Bacillales
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MarR
By pathway - Osmotic stress response

Regulated operons
	Locus Tag	Name	Function
Position: -89 Score: 7.4 Sequence: TAAACTTTTTATTTTATAAAGTTTG Locus tag: BPUM_3043 Name: opuCA Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA Locus tag: BPUM_3042 Name: opuCB Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB Locus tag: BPUM_3041 Name: opuCC Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein Locus tag: BPUM_3040 Name: opuCD Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD
	BPUM_3043	opuCA	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA
	BPUM_3042	opuCB	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB
	BPUM_3041	opuCC	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein
	BPUM_3040	opuCD	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD
Position: -205 Score: 7.4 Sequence: CAAACTTTATAAAATAAAAAGTTTA Locus tag: BPUM_3044 Name: yvaV Funciton: Transcriptional regulator of choline transport, MarR family
	BPUM_3044	yvaV	Transcriptional regulator of choline transport, MarR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD