Regulon of YvbF/YvaV in Bacillus subtilis subsp. subtilis str. 168

Properties
Regulator type:	Transcription factor
TF locus tag:	BSU33740, BSU33840
Regulator family:	MarR
Regulation mode:	repressor
Biological process:	Osmotic stress response
Effector:
Regulog:	YvbF/YvaV - Bacillales
Statistics of regulated genes:
- Genes	10
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Bacillales
By TF family - MarR
By pathway - Osmotic stress response

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 7.5 Sequence: TAAACTTTTTATTTTACAAAGTTCA Locus tag: BSU33830 Name: opuCA Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA Locus tag: BSU33820 Name: opuCB Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB Locus tag: BSU33810 Name: opuCC Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein Locus tag: BSU33800 Name: opuCD Funciton: Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD
	BSU33830	opuCA	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, ATP-binding protein OpuCA
	BSU33820	opuCB	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCB
	BSU33810	opuCC	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, substrate-binding protein
	BSU33800	opuCD	Osmotically activated L-carnitine/crotonobetaine/gamma-butyrobetaine/choline-O-sulphate/ectoine/choline ABC transporter, permease protein OpuCD
Position: -203 Score: 7.5 Sequence: TGAACTTTGTAAAATAAAAAGTTTA Locus tag: BSU33840 Name: yvbF Funciton: Transcriptional regulator of choline transport, MarR family
	BSU33840	yvbF	Transcriptional regulator of choline transport, MarR family
Position: -198 Score: 7.1 Sequence: TAAAGTTTATAAAATAAAAAGTTTA Locus tag: BSU33740 Name: yvaV Funciton: Transcriptional regulator of choline transport, MarR family
	BSU33740	yvaV	Transcriptional regulator of choline transport, MarR family
Position: -110 Score: 7.1 Sequence: TAAACTTTTTATTTTATAAACTTTA Locus tag: BSU33730 Name: opuBA Funciton: Osmotically activated choline ABC transporter, ATP-binding protein OpuBA Locus tag: BSU33720 Name: opuBB Funciton: Osmotically activated choline ABC transporter, permease protein OpuBB Locus tag: BSU33710 Name: opuBC Funciton: Osmotically activated choline ABC transporter, substrate-binding protein OpuBC Locus tag: BSU33700 Name: opuBD Funciton: Osmotically activated choline ABC transporter, permease protein OpuBB
	BSU33730	opuBA	Osmotically activated choline ABC transporter, ATP-binding protein OpuBA
	BSU33720	opuBB	Osmotically activated choline ABC transporter, permease protein OpuBB
	BSU33710	opuBC	Osmotically activated choline ABC transporter, substrate-binding protein OpuBC
	BSU33700	opuBD	Osmotically activated choline ABC transporter, permease protein OpuBB

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD