Regulog PhnR - Enterobacteriales
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | repressor |
| Biological process: | Phosphonate utilization; 2-aminoethylphosphonate utilization |
| Effector: | 2-aminoethylphosphonate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Enterobacteriales
- By trascription factor - PhnR
- By TF family - GntR/Others
- By effector - 2-aminoethylphosphonate
- By pathway - Phosphonate utilization
- By pathway - 2-aminoethylphosphonate utilization
| Genome | Genes | Operons |
|---|---|---|
| Escherichia coli str. K-12 substr. MG1655 | ||
| Salmonella typhimurium LT2 | 7 | 3 |
| Citrobacter koseri ATCC BAA-895 | ||
| Klebsiella pneumoniae subsp. pneumoniae MGH 78578 | 7 | 3 |
| Enterobacter sp. 638 | ||
| Erwinia amylovora ATCC 49946 | ||
| Yersinia pestis KIM | ||
| Serratia proteamaculans 568 | ||
| Erwinia carotovora subsp. atroseptica SCRI1043 | ||
| Edwardsiella tarda EIB202 | ||
| Proteus mirabilis HI4320 | ||
| Photorhabdus luminescens subsp. laumondii TTO1 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| phnR |
|
*
Salmonella typhimurium LT2 Site: position = -131 score = 5.29201 sequence = CCTTTGGTCTATACCAGATT Gene: STM0430: 2-aminoethylphosphonate utilization regulator, GntR family |
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -153 score = 5.8309 sequence = CATTTGGTCTATACCAGATT Gene: KPN_04062: 2-aminoethylphosphonate utilization regulator, GntR family |
|
|
|
|
|
|
|
|
2-aminoethylphosphonate utilization regulator, GntR family |
| CRON 2. | |||||||||||||
| phnS |
|
*
Salmonella typhimurium LT2 Site: position = -48 score = 6.02449 sequence = AACCTGGTATAGGCCAGAAA Gene: STM0429: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -45 score = 6.21525 sequence = AATCTGGTCTACACCAGAAT Gene: KPN_04061: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
|
|
|
|
|
|
|
|
2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) |
| phnT |
|
Gene: STM0428: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
|
Gene: KPN_04060: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
|
|
|
|
|
|
|
|
2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) |
| phnU |
|
Gene: STM0427: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
|
Gene: KPN_04059: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
|
|
|
|
|
|
|
|
2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) |
| phnV |
|
Gene: STM0426: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
|
Gene: KPN_04058: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
|
|
|
|
|
|
|
|
2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1) |
| CRON 3. | |||||||||||||
| phnW |
|
*
Salmonella typhimurium LT2 Site: position = -28 score = 6.24367 sequence = AATCTGGTATAGACCAAAGG Gene: STM0431: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
|
*
Klebsiella pneumoniae subsp. pneumoniae MGH 78578 Site: position = -29 score = 6.52049 sequence = AATCTGGTATAGACCAAATG Gene: KPN_04063: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
|
|
|
|
|
|
|
|
2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) |
| phnX |
|
Gene: STM0432: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
|
Gene: KPN_04064: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
|
|
|
|
|
|
Gene: PMI3079: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
|
Phosphonoacetaldehyde hydrolase (EC 3.11.1.1) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |