Regulon of PhnR in Klebsiella pneumoniae subsp. pneumoniae MGH 78578

Properties
Regulator type:	Transcription factor
TF locus tag:	KPN_04062
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:	2-aminoethylphosphonate
Regulog:	PhnR - Enterobacteriales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - PhnR
By TF family - GntR/Others
By effector - 2-aminoethylphosphonate
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -153 Score: 5.8 Sequence: CATTTGGTCTATACCAGATT Locus tag: KPN_04062 Name: phnR Funciton: 2-aminoethylphosphonate utilization regulator, GntR family
	KPN_04062	phnR	2-aminoethylphosphonate utilization regulator, GntR family
Position: -45 Score: 6.2 Sequence: AATCTGGTCTACACCAGAAT Locus tag: KPN_04061 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: KPN_04060 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: KPN_04059 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) Locus tag: KPN_04058 Name: phnV Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
	KPN_04061	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	KPN_04060	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	KPN_04059	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
	KPN_04058	phnV	2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
Position: -29 Score: 6.5 Sequence: AATCTGGTATAGACCAAATG Locus tag: KPN_04063 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: KPN_04064 Name: phnX Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	KPN_04063	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	KPN_04064	phnX	Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD