Regulon of PhnR in Salmonella typhimurium LT2

Properties
Regulator type:	Transcription factor
TF locus tag:	STM0430
Regulator family:	GntR/Others
Regulation mode:	repressor
Biological process:	Phosphonate utilization; 2-aminoethylphosphonate utilization
Effector:	2-aminoethylphosphonate
Regulog:	PhnR - Enterobacteriales
Statistics of regulated genes:
- Genes	7
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Enterobacteriales
By trascription factor - PhnR
By TF family - GntR/Others
By effector - 2-aminoethylphosphonate
By pathway - Phosphonate utilization
By pathway - 2-aminoethylphosphonate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -48 Score: 6 Sequence: AACCTGGTATAGGCCAGAAA Locus tag: STM0429 Name: phnS Funciton: 2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1) Locus tag: STM0428 Name: phnT Funciton: 2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1) Locus tag: STM0427 Name: phnU Funciton: 2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1) Locus tag: STM0426 Name: phnV Funciton: 2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
	STM0429	phnS	2-aminoethylphosphonate ABC transporter, periplasmic binding component (TC 3.A.1.9.1)
	STM0428	phnT	2-aminoethylphosphonate ABC transporter, ATP-binding protein (TC 3.A.1.9.1)
	STM0427	phnU	2-aminoethylphosphonate ABC transporter, permease protein I (TC 3.A.1.9.1)
	STM0426	phnV	2-aminoethylphosphonate ABC transporter, permease protein II (TC 3.A.1.9.1)
Position: -131 Score: 5.3 Sequence: CCTTTGGTCTATACCAGATT Locus tag: STM0430 Name: phnR Funciton: 2-aminoethylphosphonate utilization regulator, GntR family
	STM0430	phnR	2-aminoethylphosphonate utilization regulator, GntR family
Position: -28 Score: 6.2 Sequence: AATCTGGTATAGACCAAAGG Locus tag: STM0431 Name: phnW Funciton: 2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37) Locus tag: STM0432 Name: phnX Funciton: Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)
	STM0431	phnW	2-aminoethylphosphonate:pyruvate aminotransferase (EC 2.6.1.37)
	STM0432	phnX	Phosphonoacetaldehyde hydrolase (EC 3.11.1.1)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD