Regulog RutR - Rhodospirillales

Properties
Regulator type:	Transcription factor
Regulator family:	TetR
Regulation mode:	repressor
Biological process:	Pyrimidine utilization
Effector:	Uracil
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Rhodospirillum rubrum ATCC 11170
Magnetospirillum magnetotacticum MS-1	3	1
Magnetospirillum magneticum AMB-1
Azospirillum sp. B510
Rhodospirillum centenum SW
Gluconacetobacter diazotrophicus PAl 5
Acetobacter pasteurianus IFO 3283-01
Gluconobacter oxydans 621H
Granulibacter bethesdensis CGDNIH1

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes										Function

CRON 1.
rutA	Rhodospirillum rubrum ATCC 11170	* Magnetospirillum magnetotacticum MS-1 Site: position = -121 score = 5.06331 sequence = GTTTGTGCAAACGGTCAAAT Site: position = -88 score = 5.97284 sequence = GTTTGACCAAATGGTCTGAA Gene: Magn03006049: Pyrimidine oxygenase	Magnetospirillum magneticum AMB-1	Azospirillum sp. B510	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Pyrimidine oxygenase
rutB	Rhodospirillum rubrum ATCC 11170	2 Magnetospirillum magnetotacticum MS-1 Gene: Magn03006050: Peroxyureidoacrylate / ureidoacrylate amido hydrolase Gene: Magn03006051: Peroxyureidoacrylate / ureidoacrylate amido hydrolase	Magnetospirillum magneticum AMB-1	Azospirillum sp. B510	Rhodospirillum centenum SW	Gluconacetobacter diazotrophicus PAl 5	Acetobacter pasteurianus IFO 3283-01	Gluconobacter oxydans 621H	Granulibacter bethesdensis CGDNIH1	Peroxyureidoacrylate / ureidoacrylate amido hydrolase

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --