Regulog RutR - Rhodospirillales
| Regulator type: | Transcription factor |
| Regulator family: | TetR |
| Regulation mode: | repressor |
| Biological process: | Pyrimidine utilization |
| Effector: | Uracil |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - RutR
- By taxonomy - Rhodospirillales
- By TF family - TetR
- By effector - Uracil
- By pathway - Pyrimidine utilization
| Genome | Genes | Operons |
|---|---|---|
| Rhodospirillum rubrum ATCC 11170 | ||
| Magnetospirillum magnetotacticum MS-1 | 3 | 1 |
| Magnetospirillum magneticum AMB-1 | ||
| Azospirillum sp. B510 | ||
| Rhodospirillum centenum SW | ||
| Gluconacetobacter diazotrophicus PAl 5 | ||
| Acetobacter pasteurianus IFO 3283-01 | ||
| Gluconobacter oxydans 621H | ||
| Granulibacter bethesdensis CGDNIH1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| rutA |
|
*
Magnetospirillum magnetotacticum MS-1 Site: position = -121 score = 5.06331 sequence = GTTTGTGCAAACGGTCAAAT Site: position = -88 score = 5.97284 sequence = GTTTGACCAAATGGTCTGAA Gene: Magn03006049: Pyrimidine oxygenase |
|
|
|
|
|
|
|
Pyrimidine oxygenase |
| rutB |
|
2
Magnetospirillum magnetotacticum MS-1 Gene: Magn03006050: Peroxyureidoacrylate / ureidoacrylate amido hydrolase Gene: Magn03006051: Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
|
|
|
|
|
|
|
Peroxyureidoacrylate / ureidoacrylate amido hydrolase |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |