Regulog ModE - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | ModE |
| Regulation mode: | repressor (activator) |
| Biological process: | Molybdenum homeostasis |
| Effector: | Molybdate |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - ModE
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
| Genome | Genes | Operons |
|---|---|---|
| Sinorhizobium meliloti 1021 | 3 | 1 |
| Rhizobium sp. NGR234 | 3 | 1 |
| Rhizobium leguminosarum bv. viciae 3841 | 3 | 1 |
| Rhizobium etli CFN 42 | 3 | 1 |
| Agrobacterium tumefaciens str. C58 (Cereon) | 3 | 1 |
| Mesorhizobium sp. BNC1 | ||
| Mesorhizobium loti MAFF303099 | 3 | 1 |
| Brucella melitensis 16M | ||
| Bartonella quintana str. Toulouse | ||
| Rhodopseudomonas palustris CGA009 | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | 3 | 1 |
| Nitrobacter winogradskyi Nb-255 | ||
| Azorhizobium caulinodans ORS 571 | 3 | 1 |
| Xanthobacter autotrophicus Py2 | 2 | 1 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| modA |
*
Sinorhizobium meliloti 1021 Site: position = -82 score = 5.37574 sequence = ATTGTATTTCTACGAATATAGC Gene: SMc03196: Molybdate ABC transporter, substrate-binding protein |
*
Rhizobium sp. NGR234 Site: position = -82 score = 5.47122 sequence = ATTGTATTTCTGCGGATATAGC Gene: NGR_c29840: Molybdate ABC transporter, substrate-binding protein |
*
Rhizobium leguminosarum bv. viciae 3841 Site: position = -84 score = 5.99397 sequence = GTTATATTTTCTTGGATATATC Site: position = -41 score = 5.4663 sequence = GTTATATTCGTCGCAATATTTC Gene: RL4685: Molybdate ABC transporter, substrate-binding protein |
*
Rhizobium etli CFN 42 Site: position = -42 score = 5.57296 sequence = GTTATATTCCTTGAAATATTTC Site: position = -85 score = 5.42439 sequence = GTTATATTTTCTTCGATACATC Gene: RHE_CH04071: Molybdate ABC transporter, substrate-binding protein |
*
Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -81 score = 5.0692 sequence = GATATATCCTTGAAAATATAAT Site: position = -39 score = 5.64396 sequence = GTTATATTCATCGGAATACATC Gene: Atu2561: Molybdate ABC transporter, substrate-binding protein |
Gene: Meso_2722: Molybdate ABC transporter, substrate-binding protein |
*
Mesorhizobium loti MAFF303099 Site: position = -71 score = 5.90887 sequence = GTTATATTCATGCGGATATATC Gene: mll1465: Molybdate ABC transporter, substrate-binding protein |
Gene: BMEII0005: Molybdate ABC transporter, substrate-binding protein |
|
Gene: RPA4717: Molybdate ABC transporter, substrate-binding protein |
2
Bradyrhizobium japonicum USDA 110 Gene: blr8160: Molybdate ABC transporter, substrate-binding protein Gene: blr6951: Molybdate ABC transporter, substrate-binding protein |
*
Bradyrhizobium sp. BTAi1 Site: position = -111 score = 5.68397 sequence = GATATATACGAATGGATATAGC Gene: BBta_2080: Molybdate ABC transporter, substrate-binding protein |
Gene: Nwi_0340: Molybdate ABC transporter, substrate-binding protein |
*
Azorhizobium caulinodans ORS 571 Site: position = -41 score = 5.39579 sequence = GCTATATATGAGGAGATATAAC Gene: AZC_2368: Molybdate ABC transporter, substrate-binding protein |
*
Xanthobacter autotrophicus Py2 Site: position = -38 score = 4.22954 sequence = GCTGTATATGAACGAGCATACC Gene: Xaut_3202: Molybdate ABC transporter, substrate-binding protein |
Molybdate ABC transporter, substrate-binding protein |
| modB |
Gene: SMc03197: Molybdate ABC transporter, permease protein |
Gene: NGR_c29850: Molybdate ABC transporter, permease protein |
Gene: RL4686: Molybdate ABC transporter, permease protein |
Gene: RHE_CH04072: Molybdate ABC transporter, permease protein |
Gene: Atu2562: Molybdate ABC transporter, permease protein |
Gene: Meso_2721: Molybdate ABC transporter, permease protein |
Gene: mll1464: Molybdate ABC transporter, permease protein |
Gene: BMEII0004: Molybdate ABC transporter, permease protein |
|
Gene: RPA4716: Molybdate ABC transporter, permease protein |
3
Bradyrhizobium japonicum USDA 110 Gene: blr8161: Molybdate ABC transporter, permease protein Gene: blr1719: Molybdate ABC transporter, permease protein Gene: blr6952: Molybdate ABC transporter, permease protein |
Gene: BBta_2079: Molybdate ABC transporter, permease protein |
Gene: Nwi_0339: Molybdate ABC transporter, permease protein |
Gene: AZC_2369: Molybdate ABC transporter, permease protein |
Gene: Xaut_3201: Molybdate ABC transporter, permease protein |
Molybdate ABC transporter, permease protein |
| modC |
Gene: SMc03198: Molybdate ABC transporter, ATP-binding protein |
Gene: NGR_c29860: Molybdate ABC transporter, ATP-binding protein |
Gene: RL4687: Molybdate ABC transporter, ATP-binding protein |
Gene: RHE_CH04073: Molybdate ABC transporter, ATP-binding protein |
Gene: Atu2563: Molybdate ABC transporter, ATP-binding protein |
Gene: Meso_2720: Molybdate ABC transporter, ATP-binding protein |
Gene: mll1463: Molybdate ABC transporter, ATP-binding protein |
Gene: BMEII0003: Molybdate ABC transporter, ATP-binding protein |
|
Gene: RPA4715: Molybdate ABC transporter, ATP-binding protein |
3
Bradyrhizobium japonicum USDA 110 Gene: blr8162: Molybdate ABC transporter, ATP-binding protein Gene: bll1780: Molybdate ABC transporter, ATP-binding protein Gene: blr6953: Molybdate ABC transporter, ATP-binding protein |
Gene: BBta_2078: Molybdate ABC transporter, ATP-binding protein |
Gene: Nwi_0338: Molybdate ABC transporter, ATP-binding protein |
Gene: AZC_2370: Molybdate ABC transporter, ATP-binding protein |
|
Molybdate ABC transporter, ATP-binding protein |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |