Statistics of regulated genes

Genome	Genes	Operons
Sinorhizobium meliloti 1021	3	1
Rhizobium sp. NGR234	3	1
Rhizobium leguminosarum bv. viciae 3841	3	1
Rhizobium etli CFN 42	3	1
Agrobacterium tumefaciens str. C58 (Cereon)	3	1
Mesorhizobium sp. BNC1
Mesorhizobium loti MAFF303099	3	1
Brucella melitensis 16M
Bartonella quintana str. Toulouse
Rhodopseudomonas palustris CGA009
Bradyrhizobium japonicum USDA 110
Bradyrhizobium sp. BTAi1	3	1
Nitrobacter winogradskyi Nb-255
Azorhizobium caulinodans ORS 571	3	1
Xanthobacter autotrophicus Py2	2	1

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes																Function
CRON 1.
modA	* Sinorhizobium meliloti 1021 Site: position = -82 score = 5.37574 sequence = ATTGTATTTCTACGAATATAGC Gene: SMc03196: Molybdate ABC transporter, substrate-binding protein	* Rhizobium sp. NGR234 Site: position = -82 score = 5.47122 sequence = ATTGTATTTCTGCGGATATAGC Gene: NGR_c29840: Molybdate ABC transporter, substrate-binding protein	* Rhizobium leguminosarum bv. viciae 3841 Site: position = -84 score = 5.99397 sequence = GTTATATTTTCTTGGATATATC Site: position = -41 score = 5.4663 sequence = GTTATATTCGTCGCAATATTTC Gene: RL4685: Molybdate ABC transporter, substrate-binding protein	* Rhizobium etli CFN 42 Site: position = -42 score = 5.57296 sequence = GTTATATTCCTTGAAATATTTC Site: position = -85 score = 5.42439 sequence = GTTATATTTTCTTCGATACATC Gene: RHE_CH04071: Molybdate ABC transporter, substrate-binding protein	* Agrobacterium tumefaciens str. C58 (Cereon) Site: position = -81 score = 5.0692 sequence = GATATATCCTTGAAAATATAAT Site: position = -39 score = 5.64396 sequence = GTTATATTCATCGGAATACATC Gene: Atu2561: Molybdate ABC transporter, substrate-binding protein	Mesorhizobium sp. BNC1 Gene: Meso_2722: Molybdate ABC transporter, substrate-binding protein	* Mesorhizobium loti MAFF303099 Site: position = -71 score = 5.90887 sequence = GTTATATTCATGCGGATATATC Gene: mll1465: Molybdate ABC transporter, substrate-binding protein	Brucella melitensis 16M Gene: BMEII0005: Molybdate ABC transporter, substrate-binding protein	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA4717: Molybdate ABC transporter, substrate-binding protein	2 Bradyrhizobium japonicum USDA 110 Gene: blr8160: Molybdate ABC transporter, substrate-binding protein Gene: blr6951: Molybdate ABC transporter, substrate-binding protein	* Bradyrhizobium sp. BTAi1 Site: position = -111 score = 5.68397 sequence = GATATATACGAATGGATATAGC Gene: BBta_2080: Molybdate ABC transporter, substrate-binding protein	Nitrobacter winogradskyi Nb-255 Gene: Nwi_0340: Molybdate ABC transporter, substrate-binding protein	* Azorhizobium caulinodans ORS 571 Site: position = -41 score = 5.39579 sequence = GCTATATATGAGGAGATATAAC Gene: AZC_2368: Molybdate ABC transporter, substrate-binding protein	* Xanthobacter autotrophicus Py2 Site: position = -38 score = 4.22954 sequence = GCTGTATATGAACGAGCATACC Gene: Xaut_3202: Molybdate ABC transporter, substrate-binding protein	Molybdate ABC transporter, substrate-binding protein
modB	Sinorhizobium meliloti 1021 Gene: SMc03197: Molybdate ABC transporter, permease protein	Rhizobium sp. NGR234 Gene: NGR_c29850: Molybdate ABC transporter, permease protein	Rhizobium leguminosarum bv. viciae 3841 Gene: RL4686: Molybdate ABC transporter, permease protein	Rhizobium etli CFN 42 Gene: RHE_CH04072: Molybdate ABC transporter, permease protein	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu2562: Molybdate ABC transporter, permease protein	Mesorhizobium sp. BNC1 Gene: Meso_2721: Molybdate ABC transporter, permease protein	Mesorhizobium loti MAFF303099 Gene: mll1464: Molybdate ABC transporter, permease protein	Brucella melitensis 16M Gene: BMEII0004: Molybdate ABC transporter, permease protein	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA4716: Molybdate ABC transporter, permease protein	3 Bradyrhizobium japonicum USDA 110 Gene: blr8161: Molybdate ABC transporter, permease protein Gene: blr1719: Molybdate ABC transporter, permease protein Gene: blr6952: Molybdate ABC transporter, permease protein	Bradyrhizobium sp. BTAi1 Gene: BBta_2079: Molybdate ABC transporter, permease protein	Nitrobacter winogradskyi Nb-255 Gene: Nwi_0339: Molybdate ABC transporter, permease protein	Azorhizobium caulinodans ORS 571 Gene: AZC_2369: Molybdate ABC transporter, permease protein	Xanthobacter autotrophicus Py2 Gene: Xaut_3201: Molybdate ABC transporter, permease protein	Molybdate ABC transporter, permease protein
modC	Sinorhizobium meliloti 1021 Gene: SMc03198: Molybdate ABC transporter, ATP-binding protein	Rhizobium sp. NGR234 Gene: NGR_c29860: Molybdate ABC transporter, ATP-binding protein	Rhizobium leguminosarum bv. viciae 3841 Gene: RL4687: Molybdate ABC transporter, ATP-binding protein	Rhizobium etli CFN 42 Gene: RHE_CH04073: Molybdate ABC transporter, ATP-binding protein	Agrobacterium tumefaciens str. C58 (Cereon) Gene: Atu2563: Molybdate ABC transporter, ATP-binding protein	Mesorhizobium sp. BNC1 Gene: Meso_2720: Molybdate ABC transporter, ATP-binding protein	Mesorhizobium loti MAFF303099 Gene: mll1463: Molybdate ABC transporter, ATP-binding protein	Brucella melitensis 16M Gene: BMEII0003: Molybdate ABC transporter, ATP-binding protein	Bartonella quintana str. Toulouse	Rhodopseudomonas palustris CGA009 Gene: RPA4715: Molybdate ABC transporter, ATP-binding protein	3 Bradyrhizobium japonicum USDA 110 Gene: blr8162: Molybdate ABC transporter, ATP-binding protein Gene: bll1780: Molybdate ABC transporter, ATP-binding protein Gene: blr6953: Molybdate ABC transporter, ATP-binding protein	Bradyrhizobium sp. BTAi1 Gene: BBta_2078: Molybdate ABC transporter, ATP-binding protein	Nitrobacter winogradskyi Nb-255 Gene: Nwi_0338: Molybdate ABC transporter, ATP-binding protein	Azorhizobium caulinodans ORS 571 Gene: AZC_2370: Molybdate ABC transporter, ATP-binding protein	Xanthobacter autotrophicus Py2	Molybdate ABC transporter, ATP-binding protein

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD