Regulon of ModE in Rhizobium sp. NGR234

Properties
Regulator type:	Transcription factor
TF locus tag:	NGR_c29870
Regulator family:	ModE
Regulation mode:	repressor (activator)
Biological process:	Molybdenum homeostasis
Effector:	Molybdate
Regulog:	ModE - Rhizobiales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 12 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - ModE
By TF family - ModE
By effector - Molybdate
By pathway - Molybdenum homeostasis

Regulated operons
	Locus Tag	Name	Function
Position: -82 Score: 5.5 Sequence: ATTGTATTTCTGCGGATATAGC Locus tag: NGR_c29840 Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein Locus tag: NGR_c29850 Name: modB Funciton: Molybdate ABC transporter, permease protein Locus tag: NGR_c29860 Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein
	NGR_c29840	modA	Molybdate ABC transporter, substrate-binding protein
	NGR_c29850	modB	Molybdate ABC transporter, permease protein
	NGR_c29860	modC	Molybdate ABC transporter, ATP-binding protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD