Regulon of ModE in Azorhizobium caulinodans ORS 571
Regulator type: | Transcription factor |
TF locus tag: | AZC_1791 |
Regulator family: | ModE |
Regulation mode: | repressor (activator) |
Biological process: | Molybdenum homeostasis |
Effector: | Molybdate |
Regulog: | ModE - Rhizobiales |
Statistics of regulated genes: | |
- Genes | 3 |
- Operons | 1 |
Visualization: | |
![]() |
Allows to visualize regulon content in the context of metabolic pathways |

Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - ModE
- By TF family - ModE
- By effector - Molybdate
- By pathway - Molybdenum homeostasis
Locus Tag | Name | Function | |
---|---|---|---|
Position: -41
Score: 5.4 Sequence: GCTATATATGAGGAGATATAAC
Locus tag: AZC_2368
Name: modA Funciton: Molybdate ABC transporter, substrate-binding protein
Locus tag: AZC_2369
Name: modB Funciton: Molybdate ABC transporter, permease protein
Locus tag: AZC_2370
Name: modC Funciton: Molybdate ABC transporter, ATP-binding protein |
|||
modA
|
Molybdate ABC transporter, substrate-binding protein
|
||
modB
|
Molybdate ABC transporter, permease protein
|
||
modC
|
Molybdate ABC transporter, ATP-binding protein
|
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |