Statistics of regulated genes

Genome	Genes	Operons
Hahella chejuensis KCTC 2396
Marinobacter aqueolei
Marinobacter sp. ELB17
Oceanobacter sp. RED65
Oceanospirillum sp. MED92
Marinomonas sp. MWYL1
Saccharophagus degradans 2-40
Teredinibacter turnerae T7901
Cellvibrio japonicus Ueda107
Chromohalobacter salexigens DSM 3043
Reinekea sp. MED297	7	5
Alcanivorax borkumensis SK2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes													Function
CRON 1.
mcp2	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92 Gene: MED92_03503: Hypothetical methyl-accepting chemotaxis protein	Marinomonas sp. MWYL1 Gene: Mmwyl1_3346: Hypothetical methyl-accepting chemotaxis protein	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	* Reinekea sp. MED297 Site: position = -149 score = 5.38124 sequence = ATTATTTTTGACTTAAATCAATT Gene: MED297_10246: Hypothetical methyl-accepting chemotaxis protein	Alcanivorax borkumensis SK2	Hypothetical methyl-accepting chemotaxis protein
CRON 2.
mcp	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	* Reinekea sp. MED297 Site: position = -50 score = 5.5899 sequence = ATTTGATTCATAAAAAATAAAAT Gene: MED297_09986: Methyl-accepting chemotaxis protein	Alcanivorax borkumensis SK2	Methyl-accepting chemotaxis protein
CRON 3.
nagC	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	* Reinekea sp. MED297 Site: position = -121 score = 5.77933 sequence = ATAATTTTCAGAATGAATTAAAT Gene: MED297_06339: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family	Alcanivorax borkumensis SK2	N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family
CRON 4.
nagE	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	*2 Reinekea sp. MED297 Site: position = -154 score = 5.77933 sequence = ATTTAATTCATTCTGAAAATTAT Gene: MED297_06344: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69) Gene: MED297_19592: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)	Alcanivorax borkumensis SK2	PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69)
nagF	Hahella chejuensis KCTC 2396	Marinobacter aqueolei	Marinobacter sp. ELB17	Oceanobacter sp. RED65	Oceanospirillum sp. MED92	Marinomonas sp. MWYL1	Saccharophagus degradans 2-40	Teredinibacter turnerae T7901	Cellvibrio japonicus Ueda107	Chromohalobacter salexigens DSM 3043	*2 Reinekea sp. MED297 Gene: MED297_06349: PTS system, glucose-specific IIA component (EC 2.7.1.69) / Phosphocarrier protein of PTS system / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) Site: position = -100 score = 6.02063 sequence = ATCTGATTTAAGTCAAAAAAAAT Gene: MED297_19597: PTS system, glucose-specific IIA component (EC 2.7.1.69) / Phosphocarrier protein of PTS system / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)	Alcanivorax borkumensis SK2	PTS system, glucose-specific IIA component (EC 2.7.1.69) / Phosphocarrier protein of PTS system / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9)

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD