Regulog NagC - Oceanospirillales/Alteromonadales
| Regulator type: | Transcription factor |
| Regulator family: | ROK |
| Regulation mode: | repressor |
| Biological process: | N-acetylglucosamine utilization |
| Effector: | N-acetylglucosamine-6-phosphate |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Oceanospirillales/Alteromonadales
- By trascription factor - NagC
- By TF family - ROK
- By effector - N-acetylglucosamine-6-phosphate
- By pathway - N-acetylglucosamine utilization
| Genome | Genes | Operons |
|---|---|---|
| Hahella chejuensis KCTC 2396 | ||
| Marinobacter aqueolei | ||
| Marinobacter sp. ELB17 | ||
| Oceanobacter sp. RED65 | ||
| Oceanospirillum sp. MED92 | ||
| Marinomonas sp. MWYL1 | ||
| Saccharophagus degradans 2-40 | ||
| Teredinibacter turnerae T7901 | ||
| Cellvibrio japonicus Ueda107 | ||
| Chromohalobacter salexigens DSM 3043 | ||
| Reinekea sp. MED297 | 7 | 5 |
| Alcanivorax borkumensis SK2 |
| Genes | Function | ||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||
| mcp2 |
|
|
|
|
Gene: MED92_03503: Hypothetical methyl-accepting chemotaxis protein |
Gene: Mmwyl1_3346: Hypothetical methyl-accepting chemotaxis protein |
|
|
|
|
*
Reinekea sp. MED297 Site: position = -149 score = 5.38124 sequence = ATTATTTTTGACTTAAATCAATT Gene: MED297_10246: Hypothetical methyl-accepting chemotaxis protein |
|
Hypothetical methyl-accepting chemotaxis protein |
| CRON 2. | |||||||||||||
| mcp |
|
|
|
|
|
|
|
|
|
|
*
Reinekea sp. MED297 Site: position = -50 score = 5.5899 sequence = ATTTGATTCATAAAAAATAAAAT Gene: MED297_09986: Methyl-accepting chemotaxis protein |
|
Methyl-accepting chemotaxis protein |
| CRON 3. | |||||||||||||
| nagC |
|
|
|
|
|
|
|
|
|
|
*
Reinekea sp. MED297 Site: position = -121 score = 5.77933 sequence = ATAATTTTCAGAATGAATTAAAT Gene: MED297_06339: N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family |
|
N-acetylglucosamine-6P-responsive transcriptional repressor NagC, ROK family |
| CRON 4. | |||||||||||||
| nagE |
|
|
|
|
|
|
|
|
|
|
*2
Reinekea sp. MED297 Site: position = -154 score = 5.77933 sequence = ATTTAATTCATTCTGAAAATTAT Gene: MED297_06344: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69) Gene: MED297_19592: PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69) |
|
PTS system, N-acetylglucosamine-specific IIB component (EC 2.7.1.69) / PTS system, glucose-specific IIC component (EC 2.7.1.69) |
| nagF |
|
|
|
|
|
|
|
|
|
|
*2
Reinekea sp. MED297 Gene: MED297_06349: PTS system, glucose-specific IIA component (EC 2.7.1.69) / Phosphocarrier protein of PTS system / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) Site: position = -100 score = 6.02063 sequence = ATCTGATTTAAGTCAAAAAAAAT Gene: MED297_19597: PTS system, glucose-specific IIA component (EC 2.7.1.69) / Phosphocarrier protein of PTS system / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
|
PTS system, glucose-specific IIA component (EC 2.7.1.69) / Phosphocarrier protein of PTS system / Phosphoenolpyruvate-protein phosphotransferase of PTS system (EC 2.7.3.9) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |