Regulog IscR - Moraxellaceae
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | activator (repressor) |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Proteobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Moraxellaceae
- By trascription factor - IscR
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Acinetobacter sp. ADP1 | 7 | 1 |
| Acinetobacter baumannii AB0057 | 7 | 1 |
| Psychrobacter arcticum 273-4 | 7 | 1 |
| Psychrobacter sp. PRwf-1 | 7 | 1 |
| Genes | Function | ||||
|---|---|---|---|---|---|
| CRON 1. | |||||
| iscR |
*
Acinetobacter sp. ADP1 Site: position = -96 score = 7.98869 sequence = AAACTTGACTATTTTAGTCAGGATT Gene: ACIAD1405: Iron-sulfur cluster regulator IscR |
*
Acinetobacter baumannii AB0057 Site: position = -66 score = 8.15517 sequence = AAACTTGACTATTTTAGTCGGGATT Gene: AB57_1857: Iron-sulfur cluster regulator IscR |
*
Psychrobacter arcticum 273-4 Site: position = -219 score = 7.88673 sequence = AATCTTGACTAAATTACTCGGGATT Gene: Psyc_1476: Iron-sulfur cluster regulator IscR |
*
Psychrobacter sp. PRwf-1 Site: position = -75 score = 8.05321 sequence = AATCTTGACTAGTTTACTCGGGATT Gene: PsycPRwf_1628: Iron-sulfur cluster regulator IscR |
Iron-sulfur cluster regulator IscR |
| iscS |
Gene: ACIAD1404: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: AB57_1856: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: Psyc_1477: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Gene: PsycPRwf_1629: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
Cysteine desulfurase (EC 2.8.1.7), IscS subfamily |
| iscU |
Gene: ACIAD1403: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: AB57_1855: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: Psyc_1478: Iron-sulfur cluster assembly scaffold protein IscU |
Gene: PsycPRwf_1630: Iron-sulfur cluster assembly scaffold protein IscU |
Iron-sulfur cluster assembly scaffold protein IscU |
| iscA |
Gene: ACIAD1402: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: AB57_1854: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: Psyc_1479: Iron binding protein IscA for iron-sulfur cluster assembly |
Gene: PsycPRwf_1631: Iron binding protein IscA for iron-sulfur cluster assembly |
Iron binding protein IscA for iron-sulfur cluster assembly |
| hscB |
Gene: ACIAD1400: Chaperone protein HscB |
Gene: AB57_1853: Chaperone protein HscB |
Gene: Psyc_1480: Chaperone protein HscB |
Gene: PsycPRwf_1632: Chaperone protein HscB |
Chaperone protein HscB |
| hscA |
Gene: ACIAD1399: Chaperone protein HscA |
Gene: AB57_1852: Chaperone protein HscA |
Gene: Psyc_1481: Chaperone protein HscA |
Gene: PsycPRwf_1633: Chaperone protein HscA |
Chaperone protein HscA |
| fdx |
Gene: ACIAD1398: ferredoxin, 2Fe-2S type, ISC system |
Gene: AB57_1851: ferredoxin, 2Fe-2S type, ISC system |
Gene: Psyc_1482: ferredoxin, 2Fe-2S type, ISC system |
Gene: PsycPRwf_1634: ferredoxin, 2Fe-2S type, ISC system |
ferredoxin, 2Fe-2S type, ISC system |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |