Orthologous regulated operons containing iscR gene

Properties
Regulog:	IscR - Moraxellaceae
Regulator type:	Transcription factor
Regulator family:	Rrf2
Regulation mode:	activator (repressor)
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Phylum:	Proteobacteria

Built upon 4 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Acinetobacter baumannii AB0057
Position: -66 Score: 8.15517 Sequence: AAACTTGACTATTTTAGTCGGGATT Locus tag: AB57_1857 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: AB57_1856 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: AB57_1855 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: AB57_1854 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: AB57_1853 Name: hscB Funciton: Chaperone protein HscB Locus tag: AB57_1852 Name: hscA Funciton: Chaperone protein HscA Locus tag: AB57_1851 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR-iscS-iscU-iscA-hscB-hscA-fdx	-66	8.2	AAACTTGACTATTTTAGTCGGGATT	AB57_1857
Acinetobacter sp. ADP1
Position: -96 Score: 7.98869 Sequence: AAACTTGACTATTTTAGTCAGGATT Locus tag: ACIAD1405 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: ACIAD1404 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: ACIAD1403 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: ACIAD1402 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: ACIAD1400 Name: hscB Funciton: Chaperone protein HscB Locus tag: ACIAD1399 Name: hscA Funciton: Chaperone protein HscA Locus tag: ACIAD1398 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR-iscS-iscU-iscA-hscB-hscA-fdx	-96	8	AAACTTGACTATTTTAGTCAGGATT	ACIAD1405
Psychrobacter arcticum 273-4
Position: -219 Score: 7.88673 Sequence: AATCTTGACTAAATTACTCGGGATT Locus tag: Psyc_1476 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: Psyc_1477 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: Psyc_1478 Name: nifU Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: Psyc_1479 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: Psyc_1480 Name: hscB Funciton: Chaperone protein HscB Locus tag: Psyc_1481 Name: hscA Funciton: Chaperone protein HscA Locus tag: Psyc_1482 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR-iscS-nifU-iscA-hscB-hscA-fdx	-219	7.9	AATCTTGACTAAATTACTCGGGATT	Psyc_1476
Psychrobacter sp. PRwf-1
Position: -75 Score: 8.05321 Sequence: AATCTTGACTAGTTTACTCGGGATT Locus tag: PsycPRwf_1628 Name: iscR Funciton: Iron-sulfur cluster regulator IscR Locus tag: PsycPRwf_1629 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7), IscS subfamily Locus tag: PsycPRwf_1630 Name: null Funciton: Iron-sulfur cluster assembly scaffold protein IscU Locus tag: PsycPRwf_1631 Name: iscA Funciton: Iron binding protein IscA for iron-sulfur cluster assembly Locus tag: PsycPRwf_1632 Name: hscB Funciton: Chaperone protein HscB Locus tag: PsycPRwf_1633 Name: hscA Funciton: Chaperone protein HscA Locus tag: PsycPRwf_1634 Name: fdx Funciton: ferredoxin, 2Fe-2S type, ISC system
iscR-iscS-PsycPRwf_1630-iscA-hscB-hscA-fdx	-75	8.1	AATCTTGACTAGTTTACTCGGGATT	PsycPRwf_1628