Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --

Regulog NrtR - Rhodobacterales

Properties
Regulator type: Transcription factor
Regulator family: NrtR
Regulation mode: repressor
Biological process: NAD biosynthesis
Effector: Adenosine diphosphate ribose
Phylum: Proteobacteria/alpha
Visualization:
Allows to visualize regulog content in the context of metabolic pathways
Built upon 2 sites [see more]
Member of regulog collections
Statistics of regulated genes
Genome Genes Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Sulfitobacter sp. EE-36
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Roseobacter sp. MED193 3 1
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633
Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes Function
 
CRON 1.
nrtR
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
*
Roseobacter sp. MED193

Site:
position = -38
score = 6.39222
sequence = TTATATCTAAATAGGTAATAA

Site:
position = -23
score = 6.39222
sequence = TAATAACTAAATAGGATATAA

Gene: MED193_19424: Nudix-related transcriptional regulator NrtR
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
Nudix-related transcriptional regulator NrtR
nrtX
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_19429: NrtR-regulated hypothetical OrfX, Band 7 protein domain
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
NrtR-regulated hypothetical OrfX, Band 7 protein domain
nrtY
 
Rhodobacter sphaeroides 2.4.1
 
Paracoccus denitrificans PD1222
 
Jannaschia sp. CCS1
 
Rhodobacterales bacterium HTCC2654
 
Oceanicola granulosus HTCC2516
 
Loktanella vestfoldensis SKA53
 
Oceanicola batsensis HTCC2597
 
Roseovarius nubinhibens ISM
 
Roseovarius sp. 217
 
Sulfitobacter sp. EE-36
 
Silicibacter TM1040
 
Silicibacter pomeroyi DSS-3
 
Roseobacter sp. MED193

Gene: MED193_19434: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
 
Hyphomonas neptunium ATCC 15444
 
Oceanicaulis alexandrii HTCC2633
NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
Export
Regulated Genes [ Tab delimited format ] DOWNLOAD
Regulatory Sites [ FASTA format ] DOWNLOAD