Regulog NrtR - Rhodobacterales

Properties
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Proteobacteria/alpha
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Rhodobacterales
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Statistics of regulated genes
Genome	Genes	Operons
Rhodobacter sphaeroides 2.4.1
Paracoccus denitrificans PD1222
Jannaschia sp. CCS1
Rhodobacterales bacterium HTCC2654
Oceanicola granulosus HTCC2516
Loktanella vestfoldensis SKA53
Oceanicola batsensis HTCC2597
Roseovarius nubinhibens ISM
Roseovarius sp. 217
Sulfitobacter sp. EE-36
Silicibacter TM1040
Silicibacter pomeroyi DSS-3
Roseobacter sp. MED193	3	1
Hyphomonas neptunium ATCC 15444
Oceanicaulis alexandrii HTCC2633

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes																Function

CRON 1.
nrtR	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	* Roseobacter sp. MED193 Site: position = -38 score = 6.39222 sequence = TTATATCTAAATAGGTAATAA Site: position = -23 score = 6.39222 sequence = TAATAACTAAATAGGATATAA Gene: MED193_19424: Nudix-related transcriptional regulator NrtR	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	Nudix-related transcriptional regulator NrtR
nrtX	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193 Gene: MED193_19429: NrtR-regulated hypothetical OrfX, Band 7 protein domain	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	NrtR-regulated hypothetical OrfX, Band 7 protein domain
nrtY	Rhodobacter sphaeroides 2.4.1	Paracoccus denitrificans PD1222	Jannaschia sp. CCS1	Rhodobacterales bacterium HTCC2654	Oceanicola granulosus HTCC2516	Loktanella vestfoldensis SKA53	Oceanicola batsensis HTCC2597	Roseovarius nubinhibens ISM	Roseovarius sp. 217	Sulfitobacter sp. EE-36	Silicibacter TM1040	Silicibacter pomeroyi DSS-3	Roseobacter sp. MED193 Gene: MED193_19434: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain	Hyphomonas neptunium ATCC 15444	Oceanicaulis alexandrii HTCC2633	NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulog NrtR - Rhodobacterales

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --