Profile of regulator NrtR in Rhodobacterales
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Regulog: | NrtR - Rhodobacterales |
Member of regulog collections
- By trascription factor - NrtR
- By taxonomy - Rhodobacterales
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Roseobacter sp. MED193 | |||||
| MED193_19424 | nrtR | -38 | 6.4 | TTATATCTAAATAGGTAATAA | |
| MED193_19424 | nrtR | -23 | 6.4 | TAATAACTAAATAGGATATAA | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |