Orthologous regulated operons containing nrtX gene

Properties
Regulog:	NrtR - Rhodobacterales
Regulator type:	Transcription factor
Regulator family:	NrtR
Regulation mode:	repressor
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Phylum:	Proteobacteria/alpha

Built upon 2 sites [see more]

Orthologous operons
Operon	Position	Score	Sequence	Locus Tag of the First Gene
Roseobacter sp. MED193
Position: -38 Score: 6.39222 Sequence: TTATATCTAAATAGGTAATAA Position: -23 Score: 6.39222 Sequence: TAATAACTAAATAGGATATAA Locus tag: MED193_19424 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR Locus tag: MED193_19429 Name: nrtX Funciton: NrtR-regulated hypothetical OrfX, Band 7 protein domain Locus tag: MED193_19434 Name: nrtY Funciton: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain
nrtR-nrtX-nrtY	-38	6.4	TTATATCTAAATAGGTAATAA	MED193_19424
	-23	6.4	TAATAACTAAATAGGATATAA

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --