Regulog NrtR - Rhizobiales
| Regulator type: | Transcription factor |
| Regulator family: | NrtR |
| Regulation mode: | repressor |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Phylum: | Proteobacteria/alpha |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Rhizobiales
- By trascription factor - NrtR
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Genome | Genes | Operons |
|---|---|---|
| Sinorhizobium meliloti 1021 | ||
| Rhizobium sp. NGR234 | ||
| Rhizobium leguminosarum bv. viciae 3841 | ||
| Rhizobium etli CFN 42 | 3 | 2 |
| Agrobacterium tumefaciens str. C58 (Cereon) | ||
| Mesorhizobium sp. BNC1 | ||
| Mesorhizobium loti MAFF303099 | ||
| Brucella melitensis 16M | ||
| Bartonella quintana str. Toulouse | ||
| Rhodopseudomonas palustris CGA009 | ||
| Bradyrhizobium japonicum USDA 110 | ||
| Bradyrhizobium sp. BTAi1 | 3 | 2 |
| Nitrobacter winogradskyi Nb-255 | ||
| Azorhizobium caulinodans ORS 571 | ||
| Xanthobacter autotrophicus Py2 |
| Genes | Function | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||||||||
| nrtR |
|
|
|
*
Rhizobium etli CFN 42 Site: position = -68 score = 5.69772 sequence = TTAGTGAGAAATGTCAACTAA Site: position = -46 score = 5.87767 sequence = TTAGTTGAAGATTTACACTAA Gene: RHE_PF00027: Nudix-related transcriptional regulator NrtR |
|
|
|
|
|
|
|
*
Bradyrhizobium sp. BTAi1 Site: position = -83 score = 5.25584 sequence = TAAGTGTGTCACGACAACTAA Site: position = -61 score = 5.92953 sequence = TAAGTTGGACAGTACAACTAA Gene: BBta_5113: Nudix-related transcriptional regulator NrtR |
|
|
|
Nudix-related transcriptional regulator NrtR |
| CRON 2. | ||||||||||||||||
| nrtX |
|
|
|
*
Rhizobium etli CFN 42 Site: position = -81 score = 5.69772 sequence = TTAGTTGACATTTCTCACTAA Site: position = -103 score = 5.87767 sequence = TTAGTGTAAATCTTCAACTAA Gene: RHE_PF00026: NrtR-regulated hypothetical OrfX, Band 7 protein domain |
|
|
|
|
|
|
|
*
Bradyrhizobium sp. BTAi1 Site: position = -68 score = 5.92953 sequence = TTAGTTGTACTGTCCAACTTA Site: position = -46 score = 5.25584 sequence = TTAGTTGTCGTGACACACTTA Gene: BBta_5114: NrtR-regulated hypothetical OrfX, Band 7 protein domain |
|
|
|
NrtR-regulated hypothetical OrfX, Band 7 protein domain |
| nrtY |
|
|
|
Gene: RHE_PF00025: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain |
|
|
|
|
|
|
|
Gene: BBta_5115: NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain |
|
|
|
NrtR-regulated hypothetical OrfY, PpnK-type ATP-NAD kinase domain |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |